Transcript: Mouse NM_181732.4

Mus musculus axin interactor, dorsalization associated (Aida), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Aida (108909)
Length:
3293
CDS:
460..1377

Additional Resources:

NCBI RefSeq record:
NM_181732.4
NBCI Gene record:
Aida (108909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329555 CTATTCCATTAAGACGTATTT pLKO_005 800 CDS 100% 13.200 18.480 N Aida n/a
2 TRCN0000262341 GCCCAAGCTCAACACAATAAT pLKO_005 595 CDS 100% 15.000 10.500 N AIDA n/a
3 TRCN0000192409 CGTTGGAACCATCTCAGAATA pLKO.1 2059 3UTR 100% 13.200 9.240 N Aida n/a
4 TRCN0000329554 CGTTGGAACCATCTCAGAATA pLKO_005 2059 3UTR 100% 13.200 9.240 N Aida n/a
5 TRCN0000329556 GCTAGAGTTCCTGGTACTTTA pLKO_005 904 CDS 100% 13.200 9.240 N Aida n/a
6 TRCN0000143016 GCGATAGACGAGTATCAGATA pLKO.1 550 CDS 100% 4.950 3.465 N AIDA n/a
7 TRCN0000191255 CATCAAAGTTTGCACAAGGAA pLKO.1 1354 CDS 100% 3.000 2.100 N Aida n/a
8 TRCN0000329552 CATCAAAGTTTGCACAAGGAA pLKO_005 1354 CDS 100% 3.000 2.100 N Aida n/a
9 TRCN0000192173 CCTAGCAAAGTCTCCTTAGAA pLKO.1 1855 3UTR 100% 5.625 3.375 N Aida n/a
10 TRCN0000329553 CCTAGCAAAGTCTCCTTAGAA pLKO_005 1855 3UTR 100% 5.625 3.375 N Aida n/a
11 TRCN0000193061 CGACATGTTTGGAATTGCGTA pLKO.1 659 CDS 100% 2.640 1.848 N Aida n/a
12 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 3178 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03979 pDONR223 100% 93.5% 97.7% None (many diffs) n/a
2 ccsbBroad304_03979 pLX_304 0% 93.5% 97.7% V5 (many diffs) n/a
3 TRCN0000473685 CTTAATCATGCAGCTAGGAGGGGT pLX_317 43.1% 93.5% 97.7% V5 (many diffs) n/a
Download CSV