Transcript: Human NM_182896.3

Homo sapiens ADP ribosylation factor like GTPase 13B (ARL13B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ARL13B (200894)
Length:
3815
CDS:
270..1556

Additional Resources:

NCBI RefSeq record:
NM_182896.3
NBCI Gene record:
ARL13B (200894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182896.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229360 ACCGGGTAGAACCACTTAATA pLKO_005 1339 CDS 100% 15.000 21.000 N ARL13B n/a
2 TRCN0000064951 CCGGGTAGAACCACTTAATAT pLKO.1 1340 CDS 100% 15.000 21.000 N ARL13B n/a
3 TRCN0000229359 GATATCGGGAAAGCCTATATT pLKO_005 626 CDS 100% 15.000 21.000 N ARL13B n/a
4 TRCN0000064948 CCTTAAATGAACGCATCCAAA pLKO.1 856 CDS 100% 4.950 6.930 N ARL13B n/a
5 TRCN0000218563 GGCATTAACACAGCAGTTAAA pLKO_005 1235 CDS 100% 1.320 1.848 N ARL13B n/a
6 TRCN0000064952 CCTATATTGGTGTTGGCAAAT pLKO.1 639 CDS 100% 10.800 8.640 N ARL13B n/a
7 TRCN0000229361 CATCGTAATTTGACCTAATTT pLKO_005 2034 3UTR 100% 15.000 10.500 N ARL13B n/a
8 TRCN0000064950 CCAGCCAATAGCATCTGTAAT pLKO.1 1040 CDS 100% 13.200 9.240 N ARL13B n/a
9 TRCN0000218877 CATCATTGGAATCAGCTAATG pLKO_005 1279 CDS 100% 10.800 7.560 N ARL13B n/a
10 TRCN0000064949 CCTGTCAGAAAGGTGACTCTT pLKO.1 321 CDS 100% 4.950 3.465 N ARL13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182896.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05195 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05195 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471890 TCAGTCACTACGGACACAAGATGA pLX_317 31.9% 100% 100% V5 n/a
Download CSV