Transcript: Mouse NM_182939.4

Mus musculus protein phosphatase 4, regulatory subunit 2 (Ppp4r2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppp4r2 (232314)
Length:
3641
CDS:
247..1500

Additional Resources:

NCBI RefSeq record:
NM_182939.4
NBCI Gene record:
Ppp4r2 (232314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_182939.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114143 CGTTTATGACACCAAGAGAAA pLKO.1 1184 CDS 100% 4.950 6.930 N Ppp4r2 n/a
2 TRCN0000334869 CGTTTATGACACCAAGAGAAA pLKO_005 1184 CDS 100% 4.950 6.930 N Ppp4r2 n/a
3 TRCN0000006961 ACAATGATTCAGTGGTCCCAA pLKO.1 358 CDS 100% 2.640 3.696 N PPP4R2 n/a
4 TRCN0000114145 CTAATATAAACGGGCCTGGAA pLKO.1 743 CDS 100% 2.640 2.112 N Ppp4r2 n/a
5 TRCN0000348361 CTATACTGACAGGTCTAATAT pLKO_005 729 CDS 100% 15.000 10.500 N Ppp4r2 n/a
6 TRCN0000114142 CCCAATCCTAATGTTGAATAT pLKO.1 457 CDS 100% 13.200 9.240 N Ppp4r2 n/a
7 TRCN0000334789 CCCAATCCTAATGTTGAATAT pLKO_005 457 CDS 100% 13.200 9.240 N Ppp4r2 n/a
8 TRCN0000356296 TATATTCCCTTTGATGAAATG pLKO_005 475 CDS 100% 10.800 7.560 N PPP4R2 n/a
9 TRCN0000114144 CCTGGAAACTCACCAAACTAT pLKO.1 712 CDS 100% 5.625 3.938 N Ppp4r2 n/a
10 TRCN0000114141 CCCATAACATTCGGTTGCTTT pLKO.1 2383 3UTR 100% 4.950 3.465 N Ppp4r2 n/a
11 TRCN0000006958 GCAGTATTTTACATACAGTTC pLKO.1 1521 3UTR 100% 0.000 0.000 N PPP4R2 n/a
12 TRCN0000348439 GGATCCGAGAAGAAACTATAC pLKO_005 573 CDS 100% 10.800 6.480 N Ppp4r2 n/a
13 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1156 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182939.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05060 pDONR223 100% 85.3% 81.9% None (many diffs) n/a
2 ccsbBroad304_05060 pLX_304 0% 85.3% 81.9% V5 (many diffs) n/a
3 TRCN0000477613 GTGGCCATGGTCTTCGTCTAACTT pLX_317 35% 85.3% 81.9% V5 (many diffs) n/a
Download CSV