Transcript: Human NM_182960.4

Homo sapiens PRELI domain containing 2 (PRELID2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PRELID2 (153768)
Length:
4853
CDS:
92..661

Additional Resources:

NCBI RefSeq record:
NM_182960.4
NBCI Gene record:
PRELID2 (153768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182960.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241575 GTTGAAGCTAAGCCGTATTTA pLKO_005 1171 3UTR 100% 15.000 21.000 N PRELID2 n/a
2 TRCN0000254565 AGAGTCTGTCTTCCGGGAAAG pLKO_005 457 CDS 100% 6.000 4.800 N Prelid2 n/a
3 TRCN0000241577 AGAACGTGGTTCCAGAAATTT pLKO_005 270 CDS 100% 15.000 10.500 N PRELID2 n/a
4 TRCN0000241578 AGGGAGCCCAGAAGGGAATTA pLKO_005 588 CDS 100% 13.200 9.240 N PRELID2 n/a
5 TRCN0000167058 CCAATGCGTTATGATGATTAA pLKO.1 1445 3UTR 100% 13.200 9.240 N PRELID2 n/a
6 TRCN0000241574 CAAATTGGACAGAGTTCATTC pLKO_005 489 CDS 100% 10.800 7.560 N PRELID2 n/a
7 TRCN0000241576 GAAAGTACCTAATATCCAATT pLKO_005 346 CDS 100% 10.800 7.560 N PRELID2 n/a
8 TRCN0000172994 GCTCAATCCTCGGGAAAGAAA pLKO.1 382 CDS 100% 5.625 3.938 N PRELID2 n/a
9 TRCN0000172736 GAAGAGGAGTCATGGCTCAAT pLKO.1 368 CDS 100% 4.950 3.465 N PRELID2 n/a
10 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 1905 3UTR 100% 13.200 6.600 Y C9orf139 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3475 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2082 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3475 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182960.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05076 pDONR223 100% 78.3% 78.3% None 1_87del;205_240del n/a
2 ccsbBroad304_05076 pLX_304 0% 78.3% 78.3% V5 1_87del;205_240del n/a
3 TRCN0000478938 ATCTGGGATGTCCCTGGAATAAGA pLX_317 84.9% 78.3% 78.3% V5 1_87del;205_240del n/a
Download CSV