Transcript: Mouse NM_183319.2

Mus musculus X-linked Kx blood group related, X-linked (Xkrx), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Xkrx (331524)
Length:
2898
CDS:
19..1368

Additional Resources:

NCBI RefSeq record:
NM_183319.2
NBCI Gene record:
Xkrx (331524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110828 GCGCTCACTCTTCACCAATAA pLKO.1 1242 CDS 100% 13.200 18.480 N Xkrx n/a
2 TRCN0000153971 CACCCGAAAGAAGATGCTAAT pLKO.1 426 CDS 100% 10.800 15.120 N XKRX n/a
3 TRCN0000110825 GCTGGGATATTTGTATTCTAA pLKO.1 2235 3UTR 100% 5.625 7.875 N Xkrx n/a
4 TRCN0000110829 CATGGTTCAGTTGACCCTCAT pLKO.1 255 CDS 100% 4.050 5.670 N Xkrx n/a
5 TRCN0000110826 GCTTTGTACATGGTTAGAATT pLKO.1 169 CDS 100% 0.000 0.000 N Xkrx n/a
6 TRCN0000110827 CCTGTGCAATATGTTGGCTAT pLKO.1 669 CDS 100% 4.050 2.835 N Xkrx n/a
7 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 2127 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10137 pDONR223 100% 88.2% 89.3% None (many diffs) n/a
2 ccsbBroad304_10137 pLX_304 0% 88.2% 89.3% V5 (many diffs) n/a
3 TRCN0000476356 ACCTAACCGTGAAGTCACCGCACC pLX_317 24.4% 88.2% 89.3% V5 (many diffs) n/a
Download CSV