Transcript: Human NM_198178.3

Homo sapiens melanocyte inducing transcription factor (MITF), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
MITF (4286)
Length:
4289
CDS:
132..1205

Additional Resources:

NCBI RefSeq record:
NM_198178.3
NBCI Gene record:
MITF (4286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019122 CGTGGACTATATCCGAAAGTT pLKO.1 695 CDS 100% 5.625 7.875 N MITF n/a
2 TRCN0000019121 GCATTAAAGAACTAGGTACTT pLKO.1 613 CDS 100% 4.950 3.960 N MITF n/a
3 TRCN0000019120 CGGCATTTGTTGCTCAGAATA pLKO.1 780 CDS 100% 13.200 9.240 N MITF n/a
4 TRCN0000329868 TAACATAAATGACCGCATTAA pLKO_005 599 CDS 100% 13.200 9.240 N MITF n/a
5 TRCN0000329869 TTAGCCTAGAATCAAGTTATA pLKO_005 334 CDS 100% 13.200 9.240 N MITF n/a
6 TRCN0000329863 CTGCACTGCATTCGCACAAAC pLKO_005 1216 3UTR 100% 10.800 7.560 N MITF n/a
7 TRCN0000019123 CGGGAAACTTGATTGATCTTT pLKO.1 415 CDS 100% 5.625 3.938 N MITF n/a
8 TRCN0000329793 CGGGAAACTTGATTGATCTTT pLKO_005 415 CDS 100% 5.625 3.938 N MITF n/a
9 TRCN0000019119 CCAACTTCTTTCATCAGGAAA pLKO.1 2974 3UTR 100% 4.950 3.465 N MITF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198178.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01017 pDONR223 100% 86.4% 86.4% None 91_92ins168 n/a
2 ccsbBroad304_01017 pLX_304 0% 86.4% 86.4% V5 91_92ins168 n/a
3 TRCN0000469674 TTCGCAATTCTTGTCATTTGACGT pLX_317 40.3% 86.4% 86.4% V5 91_92ins168 n/a
Download CSV