Construct: ORF TRCN0000469674
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010217.1_s317c1
- Derived from:
- ccsbBroadEn_01017
- DNA Barcode:
- TTCGCAATTCTTGTCATTTGACGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MITF (4286)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469674
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4286 | MITF | melanocyte inducing transcr... | NM_198158.3 | 100% | 100% | |
2 | human | 4286 | MITF | melanocyte inducing transcr... | NM_000248.3 | 98.5% | 98.5% | 555_572del |
3 | human | 4286 | MITF | melanocyte inducing transcr... | NM_198178.3 | 86.4% | 86.4% | 91_92ins168 |
4 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001184967.2 | 85.9% | 85.4% | (many diffs) |
5 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001354608.2 | 85.9% | 85.4% | (many diffs) |
6 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001354607.2 | 80% | 79.5% | (many diffs) |
7 | human | 4286 | MITF | melanocyte inducing transcr... | NM_198177.3 | 79.8% | 79.3% | (many diffs) |
8 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001354606.2 | 77.6% | 77% | (many diffs) |
9 | human | 4286 | MITF | melanocyte inducing transcr... | NM_006722.2 | 77.6% | 77% | (many diffs) |
10 | human | 4286 | MITF | melanocyte inducing transcr... | NM_198159.3 | 77.4% | 76.9% | (many diffs) |
11 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001354605.2 | 76.7% | 76.2% | (many diffs) |
12 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001354604.2 | 76.5% | 76% | (many diffs) |
13 | human | 4286 | MITF | melanocyte inducing transcr... | NM_001184968.2 | 22% | 21.5% | (many diffs) |
14 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505695.3 | 88.1% | 93.9% | (many diffs) |
15 | mouse | 17342 | Mitf | microphthalmia-associated t... | NM_008601.3 | 86.9% | 92.6% | (many diffs) |
16 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505696.1 | 85% | 90.2% | (many diffs) |
17 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505692.3 | 74.9% | 79.3% | (many diffs) |
18 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505693.1 | 74.9% | 79.3% | (many diffs) |
19 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505694.1 | 74.9% | 79.3% | (many diffs) |
20 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_011241244.2 | 73.4% | 79.2% | (many diffs) |
21 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_017321428.1 | 71.5% | 75.6% | (many diffs) |
22 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505691.3 | 71.3% | 75.5% | (many diffs) |
23 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505689.3 | 69.8% | 73.9% | (many diffs) |
24 | mouse | 17342 | Mitf | microphthalmia-associated t... | NM_001178049.1 | 69.7% | 73.7% | (many diffs) |
25 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505685.3 | 68.3% | 72.3% | (many diffs) |
26 | mouse | 17342 | Mitf | microphthalmia-associated t... | XM_006505684.2 | 67.7% | 71.6% | (many diffs) |
27 | mouse | 17342 | Mitf | microphthalmia-associated t... | NM_001113198.1 | 67.6% | 71.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1305
- ORF length:
- 1239
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggaaatgcta gaatataatc actatcaggt gcagacccac ctcgaaaacc 121 ccaccaagta ccacatacag caagcccaac ggcagcaggt aaagcagtac ctttctacca 181 ctttagcaaa taaacatgcc aaccaagtcc tgagcttgcc atgtccaaac cagcctggcg 241 atcatgtcat gccaccggtg ccggggagca gcgcacccaa cagccccatg gctatgctta 301 cgcttaactc caactgtgaa aaagagggat tttataagtt tgaagagcaa aacagggcag 361 agagcgagtg cccaggcatg aacacacatt cacgagcgtc ctgtatgcag atggatgatg 421 taatcgatga catcattagc ctagaatcaa gttataatga ggaaatcttg ggcttgatgg 481 atcctgcttt gcaaatggca aatacgttgc ctgtctcggg aaacttgatt gatctttatg 541 gaaaccaagg tctgccccca ccaggcctca ccatcagcaa ctcctgtcca gccaaccttc 601 ccaacataaa aagggagctc acagagtctg aagcaagagc actggccaaa gagaggcaga 661 aaaaggacaa tcacaacctg attgaacgaa gaagaagatt taacataaat gaccgcatta 721 aagaactagg tactttgatt cccaagtcaa atgatccaga catgcgctgg aacaagggaa 781 ccatcttaaa agcatccgtg gactataTCC GAAAGTTGCA ACGAGAACAG CAACGCGCAA 841 AAGAACTTGA AAACCGACAG AAGAAACTGG AGCACGCCAA CCGGCATTTG TTGCTCAGAA 901 TACAGGAACT TGAAATGCAG GCTCGAGCTC ATGGACTTTC CCTTATTCCA TCCACGGGTC 961 TCTGCTCTCC AGATTTGGTG AATCGGATCA TCAAGCAAGA ACCCGTTCTT GAGAACTGCA 1021 GCCAAGACCT CCTTCAGCAT CATGCAGACC TAACCTGTAC AACAACTCTC GATCTCACGG 1081 ATGGCACCAT CACCTTCAAC AACAACCTCG GAACTGGGAC TGAGGCCAAC CAAGCCTATA 1141 GTGTCCCCAC AAAAATGGGA TCCAAACTGG AAGACATCCT GATGGACGAC ACCCTTTCTC 1201 CCGTCGGTGT CACTGATCCA CTCCTTTCCT CAGTGTCCCC CGGAGCTTCC AAAACAAGCA 1261 GCCGGAGGAG CAGTATGAGC ATGGAAGAGA CGGAGCACAC TTGTTACCCA ACTTTCTTGT 1321 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1381 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1441 GAAAGGACGA TTCGCAATTC TTGTCATTTG ACGTACGCGT TAAGTCgaca atcaacctct 1501 ggattacaaa atttgtgaaa gatt