Transcript: Human NM_203327.2

Homo sapiens solute carrier family 23 member 2 (SLC23A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
SLC23A2 (9962)
Length:
6980
CDS:
414..2366

Additional Resources:

NCBI RefSeq record:
NM_203327.2
NBCI Gene record:
SLC23A2 (9962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070160 CCATCCTGTCTTTAGATAAAT pLKO.1 946 CDS 100% 15.000 21.000 N Slc23a2 n/a
2 TRCN0000038206 CGGCATGGAGTCGTACAATTT pLKO.1 2201 CDS 100% 13.200 10.560 N SLC23A2 n/a
3 TRCN0000333879 CGGCATGGAGTCGTACAATTT pLKO_005 2201 CDS 100% 13.200 10.560 N SLC23A2 n/a
4 TRCN0000038204 GCCAGCATCATCGAGTCTATT pLKO.1 1578 CDS 100% 13.200 10.560 N SLC23A2 n/a
5 TRCN0000294431 CATCGGTCCCTTGACCATTAC pLKO_005 1136 CDS 100% 10.800 8.640 N SLC23A2 n/a
6 TRCN0000344972 TCTCGCCTATCTCCTTATTTA pLKO_005 2540 3UTR 100% 15.000 10.500 N SLC23A2 n/a
7 TRCN0000038208 CCAGCGATCAGACATGATTTA pLKO.1 665 CDS 100% 13.200 9.240 N SLC23A2 n/a
8 TRCN0000350960 CTGTGTTCTTGATGGCATATT pLKO_005 1688 CDS 100% 13.200 9.240 N Slc23a2 n/a
9 TRCN0000370606 CTGTGTTCTTGATGGCATATT pLKO_005 1688 CDS 100% 13.200 9.240 N SLC23A2 n/a
10 TRCN0000294485 TGACAATATTCCTAGTATTAC pLKO_005 1237 CDS 100% 13.200 9.240 N SLC23A2 n/a
11 TRCN0000370562 CTGACTGGCCCAGTATGATTC pLKO_005 2848 3UTR 100% 10.800 7.560 N SLC23A2 n/a
12 TRCN0000038205 CCCGTGGTTTAAGGTTCCATA pLKO.1 1490 CDS 100% 4.950 3.465 N SLC23A2 n/a
13 TRCN0000291439 CCCGTGGTTTAAGGTTCCATA pLKO_005 1490 CDS 100% 4.950 3.465 N SLC23A2 n/a
14 TRCN0000038207 CCTGTCTTTAGATAAATGGAA pLKO.1 950 CDS 100% 3.000 2.100 N SLC23A2 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4923 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11437 pDONR223 100% 64.5% 64.3% None (many diffs) n/a
2 ccsbBroad304_11437 pLX_304 0% 64.5% 64.3% V5 (many diffs) n/a
3 TRCN0000473960 ACAGGCCTCTTGCTCTGCATGTCT pLX_317 40% 64.5% 64.3% V5 (many diffs) n/a
Download CSV