Transcript: Human NM_203399.1

Homo sapiens stathmin 1 (STMN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STMN1 (3925)
Length:
1518
CDS:
153..602

Additional Resources:

NCBI RefSeq record:
NM_203399.1
NBCI Gene record:
STMN1 (3925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312845 GATTCTCAGCCCTCGGTCAAA pLKO_005 218 CDS 100% 4.950 3.960 N Stmn1 n/a
2 TRCN0000160037 CCAGACTGTAAGATGTTGTTT pLKO.1 738 3UTR 100% 5.625 3.938 N STMN1 n/a
3 TRCN0000281294 CCAGACTGTAAGATGTTGTTT pLKO_005 738 3UTR 100% 5.625 3.938 N STMN1 n/a
4 TRCN0000160655 CTGGAGGAAATTCAGAAGAAA pLKO.1 291 CDS 100% 5.625 3.938 N STMN1 n/a
5 TRCN0000281292 CTGGAGGAAATTCAGAAGAAA pLKO_005 291 CDS 100% 5.625 3.938 N STMN1 n/a
6 TRCN0000164665 CCCTCCTGGTTGATACTTGTT pLKO.1 1100 3UTR 100% 4.950 3.465 N STMN1 n/a
7 TRCN0000071623 CCTAAATATCCAAAGACTGTA pLKO.1 638 3UTR 100% 4.950 3.465 N Stmn1 n/a
8 TRCN0000162699 CCTCCAAAGAAGAAGGATCTT pLKO.1 267 CDS 100% 4.950 3.465 N STMN1 n/a
9 TRCN0000162139 CGAGAAAGAAGTGCTTCAGAA pLKO.1 386 CDS 100% 4.950 3.465 N STMN1 n/a
10 TRCN0000071624 CGGAAGAACAAAGAATCCAAA pLKO.1 552 CDS 100% 4.950 3.465 N Stmn1 n/a
11 TRCN0000160524 CGGAAGAACAAAGAATCCAAA pLKO.1 552 CDS 100% 4.950 3.465 N STMN1 n/a
12 TRCN0000165970 GAAAGACGCAAGTCCCATGAA pLKO.1 327 CDS 100% 4.950 3.465 N STMN1 n/a
13 TRCN0000161307 GAAGAGAAACTGACCCACAAA pLKO.1 444 CDS 100% 4.950 3.465 N STMN1 n/a
14 TRCN0000159246 GAAGGCAATAGAAGAGAACAA pLKO.1 404 CDS 100% 4.950 3.465 N STMN1 n/a
15 TRCN0000161497 GCGTGTTTCTAGAGAACAGTT pLKO.1 1344 3UTR 100% 4.950 3.465 N STMN1 n/a
16 TRCN0000281293 GCGTGTTTCTAGAGAACAGTT pLKO_005 1344 3UTR 100% 4.950 3.465 N STMN1 n/a
17 TRCN0000166006 GCGAGAGAAGGATAAGCACAT pLKO.1 521 CDS 100% 4.050 2.835 N STMN1 n/a
18 TRCN0000281370 GCGAGAGAAGGATAAGCACAT pLKO_005 521 CDS 100% 4.050 2.835 N STMN1 n/a
19 TRCN0000165568 GAGCACGAGAAAGAAGTGCTT pLKO.1 381 CDS 100% 0.264 0.185 N STMN1 n/a
20 TRCN0000281295 GAGCACGAGAAAGAAGTGCTT pLKO_005 381 CDS 100% 0.264 0.185 N STMN1 n/a
21 TRCN0000071625 GCAGAAGAAAGACGCAAGTCT pLKO.1 321 CDS 100% 3.000 1.800 N Stmn1 n/a
22 TRCN0000311863 GCAGAAGAAAGACGCAAGTCT pLKO_005 321 CDS 100% 3.000 1.800 N Stmn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15489 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15489 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478516 CTAACAAGAAACCCAATCACTGCG pLX_317 81.5% 100% 100% V5 n/a
4 ccsbBroadEn_06515 pDONR223 100% 99.7% 99.3% None 133C>T n/a
5 ccsbBroad304_06515 pLX_304 0% 99.7% 99.3% V5 133C>T n/a
6 TRCN0000478946 TTCCCGTGGAGGCCCGTGGGGCAT pLX_317 69.3% 99.7% 99.3% V5 133C>T n/a
Download CSV