Transcript: Human NM_206836.2

Homo sapiens enoyl-CoA delta isomerase 2 (ECI2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ECI2 (10455)
Length:
1420
CDS:
38..1222

Additional Resources:

NCBI RefSeq record:
NM_206836.2
NBCI Gene record:
ECI2 (10455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049387 GATCTGACTAACTTCACTGAT pLKO.1 638 CDS 100% 4.950 3.960 N ECI2 n/a
2 TRCN0000289680 GATCTGACTAACTTCACTGAT pLKO_005 638 CDS 100% 4.950 3.960 N ECI2 n/a
3 TRCN0000049383 GCAACATTTCATACACCATTT pLKO.1 833 CDS 100% 10.800 7.560 N ECI2 n/a
4 TRCN0000049384 GCCATAAACACTGAGATGTAT pLKO.1 524 CDS 100% 5.625 3.938 N ECI2 n/a
5 TRCN0000289681 GCCATAAACACTGAGATGTAT pLKO_005 524 CDS 100% 5.625 3.938 N ECI2 n/a
6 TRCN0000049386 GCTATCAGATGAATGCACAAA pLKO.1 1162 CDS 100% 4.950 3.465 N ECI2 n/a
7 TRCN0000307109 GCTATCAGATGAATGCACAAA pLKO_005 1162 CDS 100% 4.950 3.465 N ECI2 n/a
8 TRCN0000049385 CCAGGAAACGAAGTGAAGCTA pLKO.1 206 CDS 100% 3.000 2.100 N ECI2 n/a
9 TRCN0000306850 CCAGGAAACGAAGTGAAGCTA pLKO_005 206 CDS 100% 3.000 2.100 N ECI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206836.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02442 pDONR223 100% 92.3% 92.3% None 1_90del n/a
2 ccsbBroad304_02442 pLX_304 0% 92.3% 92.3% V5 1_90del n/a
3 TRCN0000470211 TCTGTACGATAGGTTCAACATTTG pLX_317 40.1% 92.3% 92.3% V5 1_90del n/a
4 ccsbBroadEn_11500 pDONR223 100% 91.1% 91.1% None 1_105del n/a
5 ccsbBroad304_11500 pLX_304 0% 91.1% 91.1% V5 1_105del n/a
6 TRCN0000479728 CATTACGGAAGAAAATTAACAGTG pLX_317 33.7% 91.1% 91.1% V5 1_105del n/a
Download CSV