Transcript: Mouse NM_207523.2

Mus musculus ribosomal protein L23A (Rpl23a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rpl23a (268449)
Length:
560
CDS:
42..512

Additional Resources:

NCBI RefSeq record:
NM_207523.2
NBCI Gene record:
Rpl23a (268449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104445 CCAAAGTCAATACCCTGATAA pLKO.1 406 CDS 100% 13.200 6.600 Y Rpl23a n/a
2 TRCN0000104447 CCACTATGCTATCATCAAATT pLKO.1 257 CDS 100% 13.200 6.600 Y Rpl23a n/a
3 TRCN0000263159 GAAACAAGCTTGACCACTATG pLKO_005 244 CDS 100% 10.800 5.400 Y RPL23AP74 n/a
4 TRCN0000104446 GCCAATAAGCATCAGATCAAA pLKO.1 351 CDS 100% 5.625 2.813 Y Rpl23a n/a
5 TRCN0000104448 TCAGATCAAACAGGCTGTCAA pLKO.1 362 CDS 100% 4.950 2.475 Y Rpl23a n/a
6 TRCN0000104449 TGACCACTATGCTATCATCAA pLKO.1 254 CDS 100% 4.950 2.475 Y Rpl23a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06884 pDONR223 100% 89.5% 100% None (many diffs) n/a
2 ccsbBroad304_06884 pLX_304 0% 89.5% 100% V5 (many diffs) n/a
3 TRCN0000466199 GAATTTGCATACAAAGTAATAGGC pLX_317 60.8% 89.5% 100% V5 (many diffs) n/a
4 ccsbBroadEn_10513 pDONR223 100% 71.7% 71.1% None (many diffs) n/a
5 ccsbBroad304_10513 pLX_304 0% 71.7% 71.1% V5 (many diffs) n/a
6 TRCN0000477975 CCAATGGATACCGTATTGCATTCA pLX_317 100% 71.7% 71.1% V5 (many diffs) n/a
7 ccsbBroadEn_10512 pDONR223 100% 71.7% 71.1% None (many diffs) n/a
8 ccsbBroad304_10512 pLX_304 0% 71.7% 71.1% V5 (many diffs) n/a
9 TRCN0000465522 GAATTGCGCGCTTCAACACGCTAT pLX_317 87.8% 71.7% 71.1% V5 (many diffs) n/a
Download CSV