Transcript: Human NR_001588.2

Homo sapiens SBDS pseudogene 1 (SBDSP1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-01-25
Taxon:
Homo sapiens (human)
Gene:
SBDSP1 (155370)
Length:
992
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_001588.2
NBCI Gene record:
SBDSP1 (155370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_001588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377422 ACCATACACCGTGATCCTTAT pLKO_005 649 3UTR 100% 10.800 5.400 Y SBDS n/a
2 TRCN0000119049 CGTTTGGAACAGATGACCAAA pLKO.1 504 3UTR 100% 0.495 0.248 Y SBDS n/a
3 TRCN0000108588 GCTTCGAAATCGCCTGCTATA pLKO.1 360 3UTR 100% 10.800 5.400 Y Sbds n/a
4 TRCN0000316424 GCTTCGAAATCGCCTGCTATA pLKO_005 360 3UTR 100% 10.800 5.400 Y Sbds n/a
5 TRCN0000119048 GCCAACAGTTAGAAATCGTAT pLKO.1 879 3UTR 100% 4.950 2.475 Y SBDS n/a
6 TRCN0000310634 GCCAACAGTTAGAAATCGTAT pLKO_005 879 3UTR 100% 4.950 2.475 Y SBDS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_001588.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03217 pDONR223 100% 62.1% None (many diffs) n/a
2 ccsbBroad304_03217 pLX_304 0% 62.1% V5 (many diffs) n/a
3 TRCN0000480512 AGAATCAGAGAGGTTAAACAAAAC pLX_317 48% 62.1% V5 (many diffs) n/a
4 ccsbBroadEn_10313 pDONR223 100% 18.4% None 1_283del;467_992del n/a
5 ccsbBroad304_10313 pLX_304 0% 18.4% V5 1_283del;467_992del n/a
6 TRCN0000474972 TTCGTCAGGGGCCAAGACTACACC pLX_317 100% 18.4% V5 1_283del;467_992del n/a
Download CSV