Transcript: Human NR_002145.1

Homo sapiens olfactory receptor family 2 subfamily L member 1 pseudogene (OR2L1P), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
OR2L1P (26247)
Length:
925
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002145.1
NBCI Gene record:
OR2L1P (26247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000583913 CTCCCTCATTGACCTAAATTA pLKO_005 195 3UTR 100% 15.000 7.500 Y n/a
2 TRCN0000583929 TCTCCCTCATTGACCTAAATT pLKO_005 194 3UTR 100% 15.000 7.500 Y n/a
3 TRCN0000584083 TCTCCACACACCCATGTATTT pLKO_005 159 3UTR 100% 13.200 6.600 Y n/a
4 TRCN0000359835 CTCTCCCTCATTGACCTAAAT pLKO_005 193 3UTR 100% 13.200 6.600 Y OR2L3 n/a
5 TRCN0000061295 CCTATCCATGATTCTTCTCAT pLKO.1 123 3UTR 100% 4.950 2.475 Y OR2L3 n/a
6 TRCN0000061296 CCTTGCTGTCTACCACATGAA pLKO.1 664 3UTR 100% 4.950 2.475 Y OR2L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02938 pDONR223 100% 91.7% None (many diffs) n/a
2 ccsbBroad304_02938 pLX_304 0% 91.7% V5 (many diffs) n/a
3 TRCN0000491631 AGATCAACGCGCCCATACGCACAT pLX_317 19.9% 91.7% V5 (many diffs) n/a
Download CSV