Transcript: Human NR_002217.1

Homo sapiens PMS2 C-terminal like pseudogene (PMS2CL), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
PMS2CL (441194)
Length:
1738
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002217.1
NBCI Gene record:
PMS2CL (441194)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423170 CACCTCAGACTCTCAACTTAA pLKO_005 1114 3UTR 100% 13.200 6.600 Y PMS2 n/a
2 TRCN0000078552 CCAGTCACTGAAAGGGCTAAA pLKO.1 1218 3UTR 100% 10.800 5.400 Y PMS2 n/a
3 TRCN0000078548 CCAGGAAGATACCGGATGTAA pLKO.1 603 3UTR 100% 5.625 2.813 Y PMS2 n/a
4 TRCN0000078550 CGAGAAGTATAACTTCGAGAT pLKO.1 1052 3UTR 100% 4.050 2.025 Y PMS2 n/a
5 TRCN0000240631 AGTCACTGAAAGGGCTAAATT pLKO_005 1220 3UTR 100% 15.000 7.500 Y Pms2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002217.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14772 pDONR223 92.2% 53.4% None (many diffs) n/a
2 ccsbBroad304_14772 pLX_304 0% 53.4% V5 (many diffs) n/a
3 TRCN0000480058 GCTATCTCATTGCACGAGGCGAAG pLX_317 12.6% 53.4% V5 (many diffs) n/a
4 ccsbBroadEn_15328 pDONR223 73.3% 32.9% None 1_953del;1527_1738del n/a
5 ccsbBroad304_15328 pLX_304 0% 32.9% V5 1_953del;1527_1738del n/a
Download CSV