Transcript: Human NR_002774.3

Homo sapiens 5-hydroxytryptamine receptor 7 pseudogene 1 (HTR7P1), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
HTR7P1 (93164)
Length:
4389
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002774.3
NBCI Gene record:
HTR7P1 (93164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027420 GCTATGCAAACTCTCTCATTA pLKO.1 2169 3UTR 100% 13.200 6.600 Y Htr7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002774.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00808 pDONR223 100% 27.1% None (many diffs) n/a
2 ccsbBroad304_00808 pLX_304 0% 27.1% V5 (many diffs) n/a
3 TRCN0000488221 AACAACTTAGTTTTTTTGTTAAGT pLX_317 26.7% 26.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 3.9% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 3.9% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.9% V5 (many diffs) n/a
Download CSV