Transcript: Human NR_002932.2

Homo sapiens glutathione S-transferase mu 2 pseudogene 1 (GSTM2P1), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
GSTM2P1 (442245)
Length:
1136
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002932.2
NBCI Gene record:
GSTM2P1 (442245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154453 GCTGAAGCTCTACTCACAGTT pLKO.1 435 3UTR 100% 4.950 2.475 Y GSTM2 n/a
2 TRCN0000154925 GAAGGACTTCATCTCCCGATT pLKO.1 576 3UTR 100% 4.050 2.025 Y GSTM2 n/a
3 TRCN0000149339 GAAACTGAAGCCAGAATACTT pLKO.1 396 3UTR 100% 5.625 2.813 Y GSTM4 n/a
4 TRCN0000297897 GAAACTGAAGCCAGAATACTT pLKO_005 396 3UTR 100% 5.625 2.813 Y GSTM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06332 pDONR223 100% 51.9% None (many diffs) n/a
2 ccsbBroad304_06332 pLX_304 0% 51.9% V5 (many diffs) n/a
3 ccsbBroadEn_13866 pDONR223 100% 49.7% None (many diffs) n/a
4 TRCN0000465604 TAACCACCCTTTTATTTACAACGA pLX_317 59.4% 49.7% V5 (many diffs) n/a
5 ccsbBroadEn_06334 pDONR223 100% 49.4% None (many diffs) n/a
6 ccsbBroad304_06334 pLX_304 0% 49.4% V5 (many diffs) n/a
7 TRCN0000471453 CAGTGATATCGATAATGCGTACCT pLX_317 63.9% 49.4% V5 (many diffs) n/a
8 ccsbBroadEn_00702 pDONR223 100% 43.1% None (many diffs) n/a
9 ccsbBroad304_00702 pLX_304 0% 43.1% V5 (many diffs) n/a
10 TRCN0000469779 ATATGCGTGTAAAATATCACAGCA pLX_317 88% 43.1% V5 (many diffs) n/a
Download CSV