Transcript: Human NR_003062.1

Homo sapiens small proline rich protein 2C (pseudogene) (SPRR2C), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SPRR2C (6702)
Length:
678
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003062.1
NBCI Gene record:
SPRR2C (6702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155726 CAGCAGTGCCAGCAGAAATAT pLKO.1 228 3UTR 100% 15.000 7.500 Y SPRR2A n/a
2 TRCN0000255630 AGCAGTGCCAGCAGAAATATC pLKO_005 229 3UTR 100% 13.200 6.600 Y SPRR2D n/a
3 TRCN0000255629 GTCCACCCAAGAGCAAGTAAC pLKO_005 286 3UTR 100% 10.800 5.400 Y SPRR2D n/a
4 TRCN0000164565 CCACCTGCATCTTCTCATCAA pLKO.1 370 3UTR 100% 4.950 2.475 Y SPRR2F n/a
5 TRCN0000156201 CAGTGCCAGCAGAAATATCCT pLKO.1 231 3UTR 100% 3.000 1.500 Y SPRR2A n/a
6 TRCN0000203973 GCATCTTCTCATCAAAGCCAT pLKO.1 376 3UTR 100% 2.640 1.320 Y SPRR2F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06991 pDONR223 100% 29.6% None (many diffs) n/a
2 ccsbBroad304_06991 pLX_304 0% 29.6% V5 (many diffs) n/a
3 TRCN0000467715 TCCTGGGTCCGAGCTCTAAATTCC pLX_317 100% 29.6% V5 (many diffs) n/a
Download CSV