Transcript: Human NR_003190.2

Homo sapiens ubiquitin specific peptidase 32 pseudogene 1 (USP32P1), non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
USP32P1 (162632)
Length:
3901
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003190.2
NBCI Gene record:
USP32P1 (162632)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230368 ACCTGGACATGTCCCATTAAA pLKO_005 3471 3UTR 100% 15.000 7.500 Y USP6 n/a
2 TRCN0000011161 CCAAAGAGAAGACACTCATAT pLKO.1 1517 3UTR 100% 13.200 6.600 Y USP32P2 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 50 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000011157 CCCAGACATTAGGAGTTCATA pLKO.1 2865 3UTR 100% 5.625 2.813 Y USP32P2 n/a
5 TRCN0000011159 GCACAATTTCTGCCAAAGATT pLKO.1 1727 3UTR 100% 5.625 2.813 Y USP32P2 n/a
6 TRCN0000007335 CCCTGCAAGTTGATTCTCATT pLKO.1 3172 3UTR 100% 4.950 2.475 Y USP6 n/a
7 TRCN0000011160 CCTTCCTGATTATTCACCTTA pLKO.1 844 3UTR 100% 4.950 2.475 Y USP32P2 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 50 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488115 GTCATCACGCGGCCGTTATCCCAT pLX_317 7.3% 21.4% V5 (many diffs) n/a
2 TRCN0000492225 TATACGCCTCCTCACCATAAATTC pLX_317 8% 21.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13327 pDONR223 100% 5.4% None 1_1364del;1369G>A;1578_3901del n/a
4 ccsbBroad304_13327 pLX_304 0% 5.4% V5 1_1364del;1369G>A;1578_3901del n/a
5 TRCN0000476448 GTATAATACAGCTCGGATCTAGCC pLX_317 100% 5.4% V5 1_1364del;1369G>A;1578_3901del n/a
Download CSV