Transcript: Human NR_015451.1

Homo sapiens long intergenic non-protein coding RNA 294 (LINC00294), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LINC00294 (283267)
Length:
3322
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_015451.1
NBCI Gene record:
LINC00294 (283267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_015451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 724 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
2 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 1821 3UTR 100% 4.950 2.475 Y DENND6A n/a
3 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 699 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_015451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13781 pDONR223 100% 7.3% None (many diffs) n/a
2 ccsbBroad304_13781 pLX_304 0% 7.3% V5 (many diffs) n/a
3 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 7.3% V5 (many diffs) n/a
4 ccsbBroadEn_10792 pDONR223 100% 6.5% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 6.5% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 6.5% V5 (many diffs) n/a
7 ccsbBroadEn_12783 pDONR223 100% 5.7% None (many diffs) n/a
8 ccsbBroad304_12783 pLX_304 0% 5.7% V5 (many diffs) n/a
9 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 5.7% V5 (many diffs) n/a
10 ccsbBroadEn_11616 pDONR223 100% 5.2% None (many diffs) n/a
11 ccsbBroad304_11616 pLX_304 0% 5.2% V5 (many diffs) n/a
12 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 5.2% V5 (many diffs) n/a
Download CSV