Transcript: Human NR_022014.1

Homo sapiens high mobility group nucleosomal binding domain 2 pseudogene 46 (HMGN2P46), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
HMGN2P46 (283651)
Length:
1927
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_022014.1
NBCI Gene record:
HMGN2P46 (283651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_022014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130370 GCATTTACTTCTCTGGCTACA pLKO.1 718 3UTR 100% 4.050 2.835 N HMGN2P46 n/a
2 TRCN0000130847 GATCCACAAGGTTGTCTGCTA pLKO.1 929 3UTR 100% 2.640 1.848 N HMGN2P46 n/a
3 TRCN0000127800 GTGTGAAGAAGAAGAGGCGAT pLKO.1 769 3UTR 100% 2.160 1.512 N HMGN2P46 n/a
4 TRCN0000128036 GAAAGCTAAAGGTGCTGGAGA pLKO.1 1101 3UTR 100% 2.640 1.584 N HMGN2P46 n/a
5 TRCN0000127729 GAACTGCAGAGAAGATCCACA pLKO.1 916 3UTR 100% 2.640 1.584 N HMGN2P46 n/a
6 TRCN0000130247 CCAAGTGAAGTGTGTGCATTT pLKO.1 1124 3UTR 100% 10.800 5.400 Y HMGN2P46 n/a
7 TRCN0000127823 GCCAAGTGAAGTGTGTGCATT pLKO.1 1123 3UTR 100% 4.950 2.475 Y HMGN2P46 n/a
8 TRCN0000130752 GAGATGCCAAGTGAAGTGTGT pLKO.1 1118 3UTR 100% 2.640 1.320 Y HMGN2P46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_022014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10338 pDONR223 100% 23.3% None 1_715del;1166_1927del n/a
2 ccsbBroad304_10338 pLX_304 0% 23.3% V5 1_715del;1166_1927del n/a
3 TRCN0000474485 TGCCTTCTGTTCTGAAGACACACA pLX_317 94% 23.3% V5 1_715del;1166_1927del n/a
4 ccsbBroadEn_00754 pDONR223 100% 12.7% None (many diffs) n/a
5 ccsbBroad304_00754 pLX_304 0% 12.7% V5 (many diffs) n/a
6 TRCN0000465397 CGTGTAGCACCTTCTGGCTCTCTA pLX_317 100% 12.7% V5 (many diffs) n/a
Download CSV