Transcript: Human NR_024538.1

Homo sapiens glutathione S-transferase mu 4 (GSTM4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
GSTM4 (2948)
Length:
1359
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024538.1
NBCI Gene record:
GSTM4 (2948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000280738 TATGGACGTCTCCAATCAGCT pLKO_005 544 3UTR 100% 2.640 2.112 N GSTM4 n/a
2 TRCN0000280739 GAGGAACTTCCTACAATGATG pLKO_005 617 3UTR 100% 4.950 3.465 N GSTM4 n/a
3 TRCN0000184288 GCCCTGACTTTGAGAAACTGA pLKO.1 582 3UTR 100% 3.000 2.100 N GSTM4 n/a
4 TRCN0000280748 GCCCTGACTTTGAGAAACTGA pLKO_005 582 3UTR 100% 3.000 2.100 N GSTM4 n/a
5 TRCN0000083698 CGTTCCTTTCTCCTGTTTATT pLKO.1 989 3UTR 100% 15.000 7.500 Y GSTM1 n/a
6 TRCN0000148357 CGTTCCTTTCTCCTGTTTATT pLKO.1 989 3UTR 100% 15.000 7.500 Y GSTM4 n/a
7 TRCN0000151859 CGTTCCTTTCTCCTGTTTATT pLKO.1 989 3UTR 100% 15.000 7.500 Y GSTM2 n/a
8 TRCN0000280824 CGTTCCTTTCTCCTGTTTATT pLKO_005 989 3UTR 100% 15.000 7.500 Y GSTM4 n/a
9 TRCN0000420215 AGAAGATTCGTGTGGACATTT pLKO_005 510 3UTR 100% 13.200 6.600 Y GSTM1 n/a
10 TRCN0000149339 GAAACTGAAGCCAGAATACTT pLKO.1 595 3UTR 100% 5.625 2.813 Y GSTM4 n/a
11 TRCN0000297897 GAAACTGAAGCCAGAATACTT pLKO_005 595 3UTR 100% 5.625 2.813 Y GSTM4 n/a
12 TRCN0000154339 CCTCGTTCCTTTCTCCTGTTT pLKO.1 986 3UTR 100% 4.950 2.475 Y GSTM2 n/a
13 TRCN0000083701 CCACCGTATATTTGAGCCCAA pLKO.1 730 3UTR 100% 2.160 1.080 Y GSTM1 n/a
14 TRCN0000147236 GAATACACAGACTCAAGCTAT pLKO.1 378 3UTR 100% 4.950 2.475 Y GSTM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024538.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13866 pDONR223 100% 39.3% None (many diffs) n/a
2 TRCN0000465604 TAACCACCCTTTTATTTACAACGA pLX_317 59.4% 39.3% V5 (many diffs) n/a
3 ccsbBroadEn_06334 pDONR223 100% 34.9% None (many diffs) n/a
4 ccsbBroad304_06334 pLX_304 0% 34.9% V5 (many diffs) n/a
5 TRCN0000471453 CAGTGATATCGATAATGCGTACCT pLX_317 63.9% 34.9% V5 (many diffs) n/a
6 ccsbBroadEn_06332 pDONR223 100% 34.9% None (many diffs) n/a
7 ccsbBroad304_06332 pLX_304 0% 34.9% V5 (many diffs) n/a
Download CSV