Transcript: Human NR_026777.2

Homo sapiens zinc finger protein 37B, pseudogene (ZNF37BP), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ZNF37BP (100129482)
Length:
8726
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026777.2
NBCI Gene record:
ZNF37BP (100129482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108203 TGAGTTTAACAAAGGTGGAAA pLKO.1 1139 3UTR 100% 4.950 2.475 Y ZNF37A n/a
2 TRCN0000172586 GCCTGGCCAACATGATGAAAT pLKO.1 4210 3UTR 100% 13.200 6.600 Y SPIRE2 n/a
3 TRCN0000162166 CAACATGATGAAACCCTGTAT pLKO.1 4217 3UTR 100% 4.950 2.475 Y SWSAP1 n/a
4 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3459 3UTR 100% 4.950 2.475 Y n/a
5 TRCN0000164260 CCAACATGATGAAACCCTGTA pLKO.1 4216 3UTR 100% 4.050 2.025 Y SWSAP1 n/a
6 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3398 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026777.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07156 pDONR223 100% 18.1% None (many diffs) n/a
2 ccsbBroad304_07156 pLX_304 0% 18.1% V5 (many diffs) n/a
3 TRCN0000475629 CCGCTCCCTGAAGGTCCCTATCCC pLX_317 15.9% 18.1% V5 (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 1.8% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 1.8% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 1.8% V5 (many diffs) n/a
Download CSV