Transcript: Human NR_026838.1

Homo sapiens Down syndrome critical region 8 (DSCR8), transcript variant 4, long non-coding RNA.

Source:
NCBI, updated 2018-05-17
Taxon:
Homo sapiens (human)
Gene:
DSCR8 (84677)
Length:
825
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026838.1
NBCI Gene record:
DSCR8 (84677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115750 TCATTCAAGATGGCATTTGTT pLKO.1 220 3UTR 100% 5.625 4.500 N DSCR8 n/a
2 TRCN0000115747 GCACAACATAATGATGGTTAA pLKO.1 466 3UTR 100% 10.800 7.560 N DSCR8 n/a
3 TRCN0000115751 GAGAAAGGGTCTTCATTCATT pLKO.1 204 3UTR 100% 5.625 3.938 N DSCR8 n/a
4 TRCN0000115749 ACTGTGAGAAAGGGTCTTCAT pLKO.1 199 3UTR 100% 4.950 3.465 N DSCR8 n/a
5 TRCN0000115748 TCATTCATTCAAGATGGCATT pLKO.1 216 3UTR 100% 4.050 2.835 N DSCR8 n/a
6 TRCN0000121665 GAAATCAAGAAAGTTCTGGAA pLKO.1 616 3UTR 100% 2.640 1.848 N DSCR8 n/a
7 TRCN0000122462 GCTGTTCATGCCAAGACCGAA pLKO.1 644 3UTR 100% 2.640 1.848 N DSCR8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10268 pDONR223 100% 33% None 1_171del;252_508del;702_825del n/a
2 ccsbBroad304_10268 pLX_304 0% 33% V5 1_171del;252_508del;702_825del n/a
3 TRCN0000475848 TATACATACCTCTTGTATGGTGAC pLX_317 97.9% 33% V5 1_171del;252_508del;702_825del n/a
4 ccsbBroadEn_10267 pDONR223 100% 12.6% None (many diffs) n/a
5 ccsbBroad304_10267 pLX_304 0% 12.6% V5 (many diffs) n/a
6 TRCN0000471034 CGGAATCTGCCTTTATGCCGCCGC pLX_317 100% 12.6% V5 (many diffs) n/a
Download CSV