Transcript: Human NR_026857.1

Homo sapiens BAIAP2 divergent transcript (BAIAP2-DT), long non-coding RNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
BAIAP2-DT (440465)
Length:
4421
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026857.1
NBCI Gene record:
BAIAP2-DT (440465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160624 CCCTTGTCTTAGTATTAGAAA pLKO.1 3549 3UTR 100% 5.625 7.875 N BAIAP2-DT n/a
2 TRCN0000164486 CAGTAACCAGAAAGTTCCAGA pLKO.1 2222 3UTR 100% 2.640 2.112 N BAIAP2-DT n/a
3 TRCN0000161717 CCAGGCATAAAGTGACATAAA pLKO.1 2874 3UTR 100% 13.200 9.240 N BAIAP2-DT n/a
4 TRCN0000159692 GTAATCAGTAACCAGAAAGTT pLKO.1 2217 3UTR 100% 5.625 3.938 N BAIAP2-DT n/a
5 TRCN0000164370 CAATCAGAACTCCTCTTCCTT pLKO.1 2173 3UTR 100% 3.000 2.100 N BAIAP2-DT n/a
6 TRCN0000162132 CACTTGTAATCAGTAACCAGA pLKO.1 2212 3UTR 100% 2.640 1.848 N BAIAP2-DT n/a
7 TRCN0000166377 CCGTTTCTTTGCTTCCTGGAT pLKO.1 2424 3UTR 100% 2.640 1.848 N BAIAP2-DT n/a
8 TRCN0000164731 CTTTGCCTTCTCTCCAAGAGA pLKO.1 2142 3UTR 100% 3.000 1.800 N BAIAP2-DT n/a
9 TRCN0000165230 GCAGTGGCTTACACCTGTAAT pLKO.1 3588 3UTR 100% 13.200 6.600 Y BAIAP2-DT n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4140 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10641 pDONR223 100% 12.4% None 1_2081del;2634_4421del n/a
2 ccsbBroad304_10641 pLX_304 0% 12.4% V5 1_2081del;2634_4421del n/a
3 TRCN0000478060 GCGACCCTATGTTCGGTCACCTCG pLX_317 73.7% 12.4% V5 1_2081del;2634_4421del n/a
Download CSV