Transcript: Human NR_027053.2

Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 2 pseudogene (LOC646214), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
LOC646214 (646214)
Length:
8226
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027053.2
NBCI Gene record:
LOC646214 (646214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002115 CTCTAGGAACCAAAGTGATTT pLKO.1 5001 3UTR 100% 13.200 6.600 Y PAK2 n/a
2 TRCN0000279743 CTCTAGGAACCAAAGTGATTT pLKO_005 5001 3UTR 100% 13.200 6.600 Y PAK2 n/a
3 TRCN0000025210 CCCAATATTTCGGGATTTCTT pLKO.1 4015 3UTR 100% 5.625 2.813 Y Pak2 n/a
4 TRCN0000199395 CCATCCATGTTGGCTTTGATG pLKO.1 2861 3UTR 100% 4.950 2.475 Y PAK2 n/a
5 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 1342 3UTR 100% 4.950 2.475 Y SPC25 n/a
6 TRCN0000194671 CGGGATTTCTTAAATCGATGT pLKO.1 4025 3UTR 100% 4.050 2.025 Y PAK2 n/a
7 TRCN0000279809 CGGGATTTCTTAAATCGATGT pLKO_005 4025 3UTR 100% 4.050 2.025 Y PAK2 n/a
8 TRCN0000025211 CCAATCACAGTTTGAAACCTT pLKO.1 2711 3UTR 100% 3.000 1.500 Y Pak2 n/a
9 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 1349 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
10 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 1349 3UTR 100% 4.950 2.475 Y SPC25 n/a
11 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 6756 3UTR 100% 4.950 2.475 Y C16orf89 n/a
12 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 6721 3UTR 100% 4.950 2.475 Y CCNJL n/a
13 TRCN0000002117 GTCTCTGGGTATCATGGCTAT pLKO.1 3886 3UTR 100% 4.050 2.025 Y PAK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027053.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489535 GCAGTAAATGTCCGGGTTTTCCCC pLX_317 25.3% 18.2% V5 (many diffs) n/a
2 ccsbBroadEn_14727 pDONR223 0% 18.2% None (many diffs) n/a
3 ccsbBroad304_14727 pLX_304 0% 18.2% V5 (many diffs) n/a
Download CSV