Transcript: Human NR_027250.2

Homo sapiens SSX family member 8, pseudogene (SSX8P), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
SSX8P (280659)
Length:
1447
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027250.2
NBCI Gene record:
SSX8P (280659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115729 CTTCAATGATATTGCCACATA pLKO.1 356 3UTR 100% 4.950 3.465 N SSX8P n/a
2 TRCN0000115730 CCAGGGATGATGATAAAGCAT pLKO.1 316 3UTR 100% 3.000 1.800 N SSX8P n/a
3 TRCN0000021665 CCCACCTTTCATGTGTAATAA pLKO.1 485 3UTR 100% 15.000 7.500 Y SSX1 n/a
4 TRCN0000115725 CTCCCACCTTTCATGTGTAAT pLKO.1 483 3UTR 100% 13.200 6.600 Y SSX9P n/a
5 TRCN0000115839 CCAGCAGAGGAAGGAAATGAT pLKO.1 630 3UTR 100% 5.625 2.813 Y SSX7 n/a
6 TRCN0000157378 CCAGCAGAGGAAGGAAATGAT pLKO.1 630 3UTR 100% 5.625 2.813 Y SSX5 n/a
7 TRCN0000021664 GCCACATACTTCTCTAAGAAA pLKO.1 369 3UTR 100% 5.625 2.813 Y SSX1 n/a
8 TRCN0000115728 CCAGAGAATCATCCCGAAGAT pLKO.1 596 3UTR 100% 4.950 2.475 Y SSX8P n/a
9 TRCN0000115724 CCTCCCACCTTTCATGTGTAA pLKO.1 482 3UTR 100% 4.950 2.475 Y SSX9P n/a
10 TRCN0000115727 CCTGAGGAAGATGATGAGTAA pLKO.1 832 3UTR 100% 4.950 2.475 Y SSX8P n/a
11 TRCN0000115731 GCTATGTGTATATGAAGAGAA pLKO.1 424 3UTR 100% 4.950 2.475 Y SSX8P n/a
12 TRCN0000020147 GCTGGTGATTTATGAAGAGAT pLKO.1 804 3UTR 100% 4.950 2.475 Y SSX3 n/a
13 TRCN0000157537 GTGTGCCAAGAGTTCGATGTT pLKO.1 1006 3UTR 100% 4.950 2.475 Y SSX5 n/a
14 TRCN0000115807 GCAAGTGTTCACAACAGTGAA pLKO.1 963 3UTR 100% 0.495 0.248 Y SSX6P n/a
15 TRCN0000152838 GCAAGTGTTCACAACAGTGAA pLKO.1 963 3UTR 100% 0.495 0.248 Y SSX5 n/a
16 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1273 3UTR 100% 4.950 2.475 Y KAAG1 n/a
17 TRCN0000021666 CGCAGGATTCAGGTTGAACAT pLKO.1 552 3UTR 100% 4.950 2.475 Y SSX1 n/a
18 TRCN0000115722 GCCCATGATGAGAAGCAGAAT pLKO.1 876 3UTR 100% 4.950 2.475 Y SSX9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01604 pDONR223 100% 37.3% None (many diffs) n/a
2 ccsbBroad304_01604 pLX_304 0% 37.3% V5 (many diffs) n/a
3 TRCN0000467573 GAGGTGCGGTAGTGGCTGTCGGAC pLX_317 86% 37.3% V5 (many diffs) n/a
4 ccsbBroadEn_02358 pDONR223 100% 35.1% None (many diffs) n/a
5 ccsbBroad304_02358 pLX_304 0% 35.1% V5 (many diffs) n/a
6 TRCN0000472750 CCACTTCCGTACTCCCCGCTCGCG pLX_317 74.7% 35.1% V5 (many diffs) n/a
7 TRCN0000487987 CTCGTAAATATTTCCCCCGTTCGT pLX_317 48.3% 35.1% V5 (many diffs) n/a
8 TRCN0000487931 GACCATATAATGACCGGCCAGGGG pLX_317 48.5% 35.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_07001 pDONR223 100% 35% None (many diffs) n/a
10 ccsbBroad304_07001 pLX_304 0% 35% V5 (many diffs) n/a
11 TRCN0000479224 GCACGATTCGGCACCAGTAAATTC pLX_317 64.8% 34.9% V5 (many diffs) n/a
12 ccsbBroadEn_07003 pDONR223 100% 35% None (many diffs) n/a
13 ccsbBroad304_07003 pLX_304 0% 35% V5 (many diffs) n/a
14 TRCN0000475229 CCACCCTATAATTCAACTACCTAC pLX_317 62.8% 35% V5 (many diffs) n/a
15 ccsbBroadEn_02357 pDONR223 100% 30.8% None (many diffs) n/a
16 ccsbBroad304_02357 pLX_304 0% 30.8% V5 (many diffs) n/a
17 TRCN0000479719 TGCAACAGTCTTCCTTTAACGATA pLX_317 61.3% 30.8% V5 (many diffs) n/a
Download CSV