Transcript: Human NR_027270.1

Homo sapiens ankyrin repeat domain 20 family member A11, pseudogene (ANKRD20A11P), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ANKRD20A11P (391267)
Length:
1095
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027270.1
NBCI Gene record:
ANKRD20A11P (391267)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155908 CAAGAAAGTGTCAGAGCCTTT pLKO.1 755 3UTR 100% 4.050 2.430 N ANKRD20A11P n/a
2 TRCN0000157899 CCAAGAAAGTGTCAGAGCCTT pLKO.1 754 3UTR 100% 2.640 1.584 N ANKRD20A11P n/a
3 TRCN0000262905 TGTGAAAGGAGCAGTACAAAG pLKO_005 884 3UTR 100% 10.800 5.400 Y ANKRD20A4 n/a
4 TRCN0000155962 CTGTGAAAGGAGCAGTACAAA pLKO.1 883 3UTR 100% 5.625 2.813 Y ANKRD20A11P n/a
5 TRCN0000154355 CTTCAGAGGAAGAGCAACAAA pLKO.1 949 3UTR 100% 5.625 2.813 Y ANKRD20A11P n/a
6 TRCN0000156157 CCTAGCACTGAAATGGAAGAT pLKO.1 858 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
7 TRCN0000158171 CCTTGAAGCCTAGCACTGAAA pLKO.1 850 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
8 TRCN0000156881 GCTGTGAAAGGAGCAGTACAA pLKO.1 882 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
9 TRCN0000156610 GCTTCAGAGGAAGAGCAACAA pLKO.1 948 3UTR 100% 4.950 2.475 Y ANKRD20A11P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027270.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13664 pDONR223 100% 24.3% None (many diffs) n/a
2 ccsbBroad304_13664 pLX_304 0% 24.3% V5 (many diffs) n/a
3 TRCN0000477985 GGTTGACGTCGGCTACCACGCATT pLX_317 100% 24.3% V5 (many diffs) n/a
Download CSV