Construct: ORF TRCN0000488868
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020218.1_s317c1
- DNA Barcode:
- CCATATAGGAAATTTCAAACAAAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PIP5K1A (8394)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488868
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135637.2 | 99.9% | 100% | 930C>T |
2 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_003557.3 | 91% | 91% | 930C>T;1325_1471del |
3 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001330689.2 | 90.8% | 90.9% | 83_85delCAG;933C>T;1328_1474del |
4 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245528.5 | 89.2% | 89.2% | 83_115del;963C>T;1358_1504del |
5 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245527.4 | 89% | 89.1% | 117_152del;966C>T;1361_1507del |
6 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135638.2 | 88.9% | 88.9% | (many diffs) |
7 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711564.4 | 88.9% | 88.9% | 84_122del;969C>T;1364_1510del |
8 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245525.5 | 87.3% | 87.4% | (many diffs) |
9 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711563.4 | 87% | 87.1% | (many diffs) |
10 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002440.1 | 86.5% | 88.7% | 930C>T;1324_1325ins130;1371_1452del |
11 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002439.1 | 86.3% | 88.5% | (many diffs) |
12 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510046.3 | 85.9% | 86% | (many diffs) |
13 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245532.4 | 85.8% | 85.8% | (many diffs) |
14 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135636.2 | 85.7% | 85.6% | (many diffs) |
15 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450130.1 | 84.7% | 84% | (many diffs) |
16 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510043.3 | 84.6% | 84.5% | (many diffs) |
17 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450131.1 | 84.6% | 84.6% | 0_1ins105;825C>T;1220_1366del |
18 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711567.4 | 84.4% | 82.8% | (many diffs) |
19 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510048.3 | 84.4% | 82.8% | (many diffs) |
20 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510049.3 | 84.4% | 82.8% | (many diffs) |
21 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002441.2 | 84.4% | 82.8% | (many diffs) |
22 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510045.3 | 84.1% | 84.2% | (many diffs) |
23 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245530.5 | 84% | 84% | (many diffs) |
24 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450129.1 | 83% | 82.3% | (many diffs) |
25 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711568.4 | 82.9% | 82.7% | (many diffs) |
26 | human | 266971 | PIPSL | PIP5K1A and PSMD4 like (pse... | NR_002319.2 | 37.5% | (many diffs) | |
27 | human | 206426 | PIP5K1P1 | phosphatidylinositol-4-phos... | NR_027712.1 | 33.1% | (many diffs) | |
28 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XM_017319485.1 | 86.7% | 91.2% | (many diffs) |
29 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | NM_001293707.1 | 79.2% | 83.3% | (many diffs) |
30 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | NM_008847.3 | 79.2% | 83.3% | (many diffs) |
31 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XR_375499.2 | 33.7% | (many diffs) | |
32 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XR_375498.2 | 33.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1572
- ORF length:
- 1500
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcgtcg gcctcctccg ggccgtcgtc ttcggtcggt ttttcatcct 121 ttgatcccgc ggtcccttcc tgtaccttgt cctcagcatc tggaatcaag agacccatgg 181 catctgaggt gccttatgcc tctggcatgc ccatcaagaa aataggccat agaagtgttg 241 attcctcagg agagacaaca tataaaaaga caacctcatc agccttgaaa ggtgccatcc 301 agttaggcat tacccacact gtggggagcc tgagtaccaa accagagcgt gatgtcctca 361 tgcaagattt ctacgtggtt gagagtatct tctttcccag tgaagggagc aacctgaccc 421 ctgctcatca ctacaatgac tttcgtttca agacctatgc acctgttgcc ttccgctact 481 tccgggagct atttggtatc cggcccgatg attacttgta ttccctctgc agtgagccgc 541 tgattgaact ctgtagctct ggagctagtg gttccctatt ctatgtgtcc agcgacgatg 601 agttcattat taagacagtc caacataaag aggcggaatt tctgcagaag ctgcttccag 661 gatactacat gaacctcaac cagaaccctc ggactttgct gcctaaattc tatggactgt 721 actgtgtgca ggcaggtggc aagaacattc ggattgtggt gatgaacaat cttttaccaa 781 gatcggtaaa aatgcatatc aaatatgacc tcaaaggctc aacctacaaa cggcgggctt 841 cccagaaaga gcgagagaag cctcttccca catttaaaga cctagacttc ttacaagaca 901 tccctgatgg tctttttttg gatgctgaca tgtacaacgc tctctgtaag accctgcagc 961 gtgactgttt ggtgctgcag agcttcaaga taatggatta tagcctcttg atgtcaatcc 1021 ataatataga tcatgcacaa cgagagccct taagcagtga aacacagtac tcagttgata 1081 ctcgaagacc ggccccccaa aaggctctgt attccacagc catggaatcc atccagggag 1141 aggctcgacg gggtggtacc atggagactg atgaccatat gggtggcatc cctgcccgga 1201 atagtaaagg ggaaaggctt ctgctttata ttggcatcat tgaCATTCTA CAGTCTTACA 1261 GGTTTGTTAA GAAGTTGGAG CACTCTTGGA AAGCCCTGGT ACATGACGGA GACACTGTCT 1321 CAGTGCATCG CCCAGGCTTC TACGCTGAAC GGTTCCAGCG CTTCATGTGC AACACAGTAT 1381 TTAAGAAGAT TCCCTGCGTT CACCTTGGTC GTCCTGATGT TTTACCTCAG ACTCCACCTT 1441 TGGAGGAAAT CAGTGAGGGC TCGCCTATTC CTGACCCCAG TTTCTCACCT CTAGTTGGAG 1501 AGACTTTGCA AATGCTAACT ACAAGTACAA CCTTGGAAAA GCTTGAAGTT GCAGAGTCAG 1561 AGTTCACCCA TTGAGACCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1621 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1681 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCATATAGGA AATTTCAAAC 1741 AAATACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt