Transcript: Human NR_027713.1

Homo sapiens keratin 8 pseudogene 41 (KRT8P41), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
KRT8P41 (283102)
Length:
1828
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027713.1
NBCI Gene record:
KRT8P41 (283102)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116956 GCTGGCTGTTAAGGATGCCAA pLKO.1 1149 3UTR 100% 2.640 1.848 N KRT8P11 n/a
2 TRCN0000305998 AGCGTACAGAGATGGAGAATG pLKO_005 672 3UTR 100% 10.800 5.400 Y Krt8 n/a
3 TRCN0000084030 CAACAAGTTTGCCTCCTTCAT pLKO.1 427 3UTR 100% 4.950 2.475 Y KRT6A n/a
4 TRCN0000062383 CTGGACATGGACAGCATCATT pLKO.1 880 3UTR 100% 5.625 2.813 Y KRT8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10940 pDONR223 100% 40.5% None (many diffs) n/a
2 ccsbBroad304_10940 pLX_304 0% 40.5% V5 (many diffs) n/a
3 TRCN0000467772 ACAAATATGTCAAGAGTTCTGACC pLX_317 14.7% 40.5% V5 (many diffs) n/a
4 ccsbBroadEn_10589 pDONR223 100% 32.3% None 1_732del;1324_1828del n/a
5 ccsbBroad304_10589 pLX_304 0% 32.3% V5 1_732del;1324_1828del n/a
6 TRCN0000479434 TTCTGCTTCAGCTGTCCAGGAGGT pLX_317 42.9% 32.3% V5 1_732del;1324_1828del n/a
7 ccsbBroadEn_12931 pDONR223 100% 16% None (many diffs) n/a
8 ccsbBroad304_12931 pLX_304 0% 16% V5 (many diffs) n/a
9 TRCN0000471683 GTTCGCATTGACTCGACCACCATG pLX_317 100% 16% V5 (many diffs) n/a
Download CSV