Transcript: Human NR_028105.1

Homo sapiens DDB1 and CUL4 associated factor 8 (DCAF8), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
DCAF8 (50717)
Length:
1728
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028105.1
NBCI Gene record:
DCAF8 (50717)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242444 GCCATACTGGTTGTGTCAATA pLKO_005 1084 3UTR 100% 13.200 18.480 N DCAF8 n/a
2 TRCN0000250208 GCCATACTGGTTGTGTCAATA pLKO_005 1084 3UTR 100% 13.200 18.480 N Dcaf8 n/a
3 TRCN0000242443 GGCAGAACAGACTTAGCTAAT pLKO_005 540 3UTR 100% 10.800 8.640 N DCAF8 n/a
4 TRCN0000242445 ATGGAGGACACTGGTCATTAC pLKO_005 753 3UTR 100% 10.800 7.560 N DCAF8 n/a
5 TRCN0000167447 GAACAGACTTAGCTAATGGAA pLKO.1 544 3UTR 100% 3.000 2.100 N DCAF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15812 pDONR223 0% 47.3% None 1_512del;716C>G;1332_1728del n/a
2 ccsbBroad304_15812 pLX_304 0% 47.3% V5 1_512del;716C>G;1332_1728del n/a
3 TRCN0000470465 AGCGCATCGCTCAATGGACGGCCG pLX_317 42.6% 47.3% V5 1_512del;716C>G;1332_1728del n/a
4 ccsbBroadEn_03151 pDONR223 100% 41.8% None (many diffs) n/a
5 ccsbBroad304_03151 pLX_304 0% 41.8% V5 (many diffs) n/a
6 TRCN0000468372 TCTATGGCCACTTGTCGCGATTAA pLX_317 23.2% 41.8% V5 (many diffs) n/a
Download CSV