Transcript: Human NR_028334.1

Homo sapiens keratin 18 pseudogene 55 (KRT18P55), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
KRT18P55 (284085)
Length:
1950
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028334.1
NBCI Gene record:
KRT18P55 (284085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117188 AGTTAGATTTACCTTCAGCTT pLKO.1 519 3UTR 100% 2.640 2.112 N KRT18P55 n/a
2 TRCN0000117189 CCAGTGTCTATGCAGGCATCA pLKO.1 696 3UTR 100% 4.050 2.835 N KRT18P55 n/a
3 TRCN0000117187 GCTGGAAGACAGTGAGGACTT pLKO.1 1740 3UTR 100% 4.050 2.835 N KRT18P55 n/a
4 TRCN0000117190 ACTGTGGACAGTGCCCACATT pLKO.1 1022 3UTR 100% 0.495 0.347 N KRT18P55 n/a
5 TRCN0000117191 GCCTGGATACCAAGAACTGGA pLKO.1 897 3UTR 100% 2.640 1.584 N KRT18P55 n/a
6 TRCN0000062364 CCTGCTGAACATCAAGGTCAA pLKO.1 1686 3UTR 100% 4.050 2.025 Y KRT18 n/a
7 TRCN0000299481 CCTGCTGAACATCAAGGTCAA pLKO_005 1686 3UTR 100% 4.050 2.025 Y KRT18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487775 GTTCAACGCCCGGGTGCCGGACCC pLX_317 21.2% 59.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06508 pDONR223 100% 59.6% None (many diffs) n/a
3 ccsbBroad304_06508 pLX_304 0% 59.6% V5 (many diffs) n/a
4 TRCN0000478565 GGTCTGGTAAACGCTAGTGTGTCC pLX_317 22.6% 59.6% V5 (many diffs) n/a
5 ccsbBroadEn_06507 pDONR223 100% 59.6% None (many diffs) n/a
6 ccsbBroad304_06507 pLX_304 0% 59.6% V5 (many diffs) n/a
7 TRCN0000474389 CTCCAGCCACTGTTTCGGCTACTC pLX_317 41.5% 59.6% V5 (many diffs) n/a
8 ccsbBroadEn_10600 pDONR223 100% 39.8% None 1_487del;1265_1950del n/a
9 ccsbBroad304_10600 pLX_304 0% 39.8% V5 1_487del;1265_1950del n/a
10 TRCN0000475856 AAAGGATTTTAGCATTTTCCACAA pLX_317 34.6% 39.8% V5 1_487del;1265_1950del n/a
Download CSV