Transcript: Human NR_033187.2

Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 4 (PIN4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PIN4 (5303)
Length:
1165
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033187.2
NBCI Gene record:
PIN4 (5303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312558 CTCTCAGTCTGTCCCATAAAT pLKO_005 636 3UTR 100% 15.000 10.500 N PIN4 n/a
2 TRCN0000049220 GCCTGTAAGTGGGATGGATAA pLKO.1 258 3UTR 100% 10.800 7.560 N PIN4 n/a
3 TRCN0000252599 GCCTGTAAGTGGGATGGATAA pLKO_005 258 3UTR 100% 10.800 7.560 N Pin4 n/a
4 TRCN0000327792 GCCTGTAAGTGGGATGGATAA pLKO_005 258 3UTR 100% 10.800 7.560 N PIN4 n/a
5 TRCN0000049218 CCGCACAGTATAGTGAAGATA pLKO.1 158 3UTR 100% 5.625 3.938 N PIN4 n/a
6 TRCN0000327765 CCGCACAGTATAGTGAAGATA pLKO_005 158 3UTR 100% 5.625 3.938 N PIN4 n/a
7 TRCN0000049222 GTCAGACACATTCTATGTGAA pLKO.1 73 3UTR 100% 4.950 2.970 N PIN4 n/a
8 TRCN0000327689 GTCAGACACATTCTATGTGAA pLKO_005 73 3UTR 100% 4.950 2.970 N PIN4 n/a
9 TRCN0000346213 TTAAAGTCTGGGATGAGATTC pLKO_005 127 3UTR 100% 10.800 5.400 Y Pin4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033187.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06729 pDONR223 100% 26.9% None (many diffs) n/a
2 TRCN0000477942 TGTGTCAAGTAATCTTTCTAGAGG pLX_317 55.8% 26.9% V5 (many diffs) n/a
3 ccsbBroadEn_15529 pDONR223 0% 25.7% None 1_29del;68_69ins74;349_1165del n/a
4 ccsbBroad304_15529 pLX_304 0% 25.7% V5 1_29del;68_69ins74;349_1165del n/a
5 TRCN0000471417 TATTTTCACACTCGAGTTCGACGA pLX_317 100% 25.6% V5 (many diffs) n/a
Download CSV