Transcript: Human NR_033423.1

Homo sapiens dihydrofolate reductase pseudogene 3 (DHFRP3), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
DHFRP3 (1720)
Length:
967
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033423.1
NBCI Gene record:
DHFRP3 (1720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421979 GAAAGGCATTAAGTACAAATT pLKO_005 541 3UTR 100% 13.200 6.600 Y DHFR n/a
2 TRCN0000039000 CCTGAGAAGAATCGACCTTTA pLKO.1 210 3UTR 100% 10.800 5.400 Y DHFR n/a
3 TRCN0000161799 CCTGAGAAGAATCGACCTTTA pLKO.1 210 3UTR 100% 10.800 5.400 Y DHFR2 n/a
4 TRCN0000038999 CCAGAAATTGATTTGGAGAAA pLKO.1 470 3UTR 100% 4.950 2.475 Y DHFR n/a
5 TRCN0000442089 GAACATGGGCATCGGCAAGAA pLKO_005 65 3UTR 100% 4.950 2.475 Y DHFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00443 pDONR223 100% 53% None (many diffs) n/a
2 ccsbBroad304_00443 pLX_304 0% 53% V5 (many diffs) n/a
3 TRCN0000478285 GCAGTACTGAGTGTACAAGCGTAG pLX_317 55.7% 53% V5 (many diffs) n/a
4 ccsbBroadEn_09809 pDONR223 100% 51.9% None (many diffs) n/a
5 ccsbBroad304_09809 pLX_304 0% 51.9% V5 (many diffs) n/a
6 TRCN0000478413 TATGTCCAACATCTCACTTAAACT pLX_317 66.6% 51.9% V5 (many diffs) n/a
Download CSV