Transcript: Mouse NR_033638.1

Mus musculus olfactory receptor 29, pseudogene 1 (Olfr29-ps1), non-coding RNA.

Source:
NCBI, updated 2013-07-16
Taxon:
Mus musculus (mouse)
Gene:
Olfr29-ps1 (29848)
Length:
963
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033638.1
NBCI Gene record:
Olfr29-ps1 (29848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000185843 GACAATGTCATCAATCACTTT pLKO.1 516 3UTR 100% 4.950 2.475 Y Olfr159 n/a
2 TRCN0000187287 CCTTGTGACAATCCTGAGGAT pLKO.1 668 3UTR 100% 2.640 1.320 Y Olfr155 n/a
3 TRCN0000187286 CGTGCAGATGTTTCTCTCCTT pLKO.1 299 3UTR 100% 2.640 1.320 Y Olfr155 n/a
4 TRCN0000188297 CGCCCATGTACTTCTTCCTAA pLKO.1 175 3UTR 100% 4.950 2.475 Y Olfr281 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03733 pDONR223 100% 83.9% None (many diffs) n/a
2 ccsbBroad304_03733 pLX_304 0% 83.9% V5 (many diffs) n/a
3 TRCN0000468846 ATCCTCCCCGATCACTCGTGTCTT pLX_317 28.3% 83.9% V5 (many diffs) n/a
Download CSV