Transcript: Human NR_033680.1

Homo sapiens caspase recruitment domain family member 8 (CARD8), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CARD8 (22900)
Length:
5066
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033680.1
NBCI Gene record:
CARD8 (22900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425005 GATGTTGAGTTGATTGATAAG pLKO_005 468 3UTR 100% 10.800 15.120 N CARD8 n/a
2 TRCN0000118330 GCCTTGCTAACAAAGGCGATA pLKO.1 981 3UTR 100% 0.405 0.567 N CARD8 n/a
3 TRCN0000421208 TCTGAAGAAGGTAGTAATATT pLKO_005 1628 3UTR 100% 15.000 10.500 N CARD8 n/a
4 TRCN0000433668 GGACATTCCCAGGAGACATTT pLKO_005 343 3UTR 100% 13.200 9.240 N CARD8 n/a
5 TRCN0000413973 ACGTGCTCTTCAGAAGCATTA pLKO_005 1362 3UTR 100% 10.800 7.560 N CARD8 n/a
6 TRCN0000424058 GTAACCTGGCATGTACCTATT pLKO_005 1575 3UTR 100% 10.800 7.560 N CARD8 n/a
7 TRCN0000118327 GCACACATATTTCCATCCTTT pLKO.1 2295 3UTR 100% 4.950 3.465 N CARD8 n/a
8 TRCN0000118329 GCACAAACAGATACAGCGTTT pLKO.1 490 3UTR 100% 4.050 2.835 N CARD8 n/a
9 TRCN0000118331 CCTTTCTATGCTGTCCTGGAA pLKO.1 816 3UTR 100% 2.640 1.848 N CARD8 n/a
10 TRCN0000118328 CCTATCTTAGACAGCAGAATT pLKO.1 1407 3UTR 100% 0.000 0.000 N CARD8 n/a
11 TRCN0000413924 GTTTCCTCTTATGCTTCTAAA pLKO_005 384 3UTR 100% 13.200 7.920 N CARD8 n/a
12 TRCN0000422111 TGAACTTTGGTTCCAGTTATA pLKO_005 1063 3UTR 100% 13.200 7.920 N CARD8 n/a
13 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 4402 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4087 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000105239 GATGATGAGGAAGATCGCTGT pLKO.1 1002 3UTR 100% 2.160 1.512 N Crabp2 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4087 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033680.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07813 pDONR223 100% 18.3% None (many diffs) n/a
2 ccsbBroad304_07813 pLX_304 0% 18.3% V5 (many diffs) n/a
3 TRCN0000468126 TTTACTGCCCTAACGTCACTTTAC pLX_317 30.3% 18.3% V5 (many diffs) n/a
4 ccsbBroadEn_10792 pDONR223 100% 4.3% None (many diffs) n/a
5 ccsbBroad304_10792 pLX_304 0% 4.3% V5 (many diffs) n/a
6 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.3% V5 (many diffs) n/a
Download CSV