Transcript: Human NR_033796.2

Homo sapiens DSTN pseudogene 2 (DSTNP2), non-coding RNA.

Source:
NCBI, updated 2019-01-23
Taxon:
Homo sapiens (human)
Gene:
DSTNP2 (171220)
Length:
1122
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033796.2
NBCI Gene record:
DSTNP2 (171220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116881 GCTTTGTATGATGCAAGCTTT pLKO.1 461 3UTR 100% 4.950 2.475 Y DSTN n/a
2 TRCN0000310417 GCTTTGTATGATGCAAGCTTT pLKO_005 461 3UTR 100% 4.950 2.475 Y DSTN n/a
3 TRCN0000116880 TGGATCCTTAATTGTAGCCTT pLKO.1 969 3UTR 100% 2.640 1.320 Y DSTN n/a
4 TRCN0000299214 TGGATCCTTAATTGTAGCCTT pLKO_005 969 3UTR 100% 2.640 1.320 Y DSTN n/a
5 TRCN0000116878 GATCTCAATCGGGCTTGTATT pLKO.1 632 3UTR 100% 13.200 6.600 Y DSTN n/a
6 TRCN0000299215 GATCTCAATCGGGCTTGTATT pLKO_005 632 3UTR 100% 13.200 6.600 Y DSTN n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 924 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 924 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02602 pDONR223 100% 40.2% None (many diffs) n/a
2 ccsbBroad304_02602 pLX_304 0% 40.2% V5 (many diffs) n/a
3 TRCN0000465993 AGCGACTTCACATGTCTCCTGTTA pLX_317 60% 40.2% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 21.5% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 21.5% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 21.5% V5 (many diffs) n/a
Download CSV