Transcript: Human NR_037872.1

Homo sapiens tektin 4 pseudogene (LOC100233156), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-09-22
Taxon:
Homo sapiens (human)
Gene:
LOC100233156 (100233156)
Length:
1631
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037872.1
NBCI Gene record:
LOC100233156 (100233156)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037872.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159185 GAGCAACAAGAAACGAATAAA pLKO.1 120 3UTR 100% 15.000 7.500 Y TEKT4P2 n/a
2 TRCN0000159736 GCAACAAGAAACGAATAAATC pLKO.1 122 3UTR 100% 13.200 6.600 Y TEKT4P2 n/a
3 TRCN0000163413 GCACGCCTTAAACACACAGAT pLKO.1 681 3UTR 100% 4.950 2.475 Y TEKT4P2 n/a
4 TRCN0000161734 CCAAGAGCAACAAGAAACGAA pLKO.1 116 3UTR 100% 3.000 1.500 Y TEKT4P2 n/a
5 TRCN0000162856 CGGGAAATCACAGATCAGGAA pLKO.1 384 3UTR 100% 2.640 1.320 Y TEKT4P2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037872.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05043 pDONR223 100% 29.8% None (many diffs) n/a
2 ccsbBroad304_05043 pLX_304 0% 29.8% V5 (many diffs) n/a
3 TRCN0000465345 ACAAAGGCTTGAAGTAACCCCAAC pLX_317 27.6% 29.8% V5 (many diffs) n/a
4 ccsbBroadEn_05743 pDONR223 100% 23.5% None (many diffs) n/a
5 ccsbBroad304_05743 pLX_304 0% 23.5% V5 (many diffs) n/a
6 TRCN0000474564 GCGGCATACTTCGGGCCGAACAGT pLX_317 100% 23.5% V5 (many diffs) n/a
Download CSV