Transcript: Mouse NR_045601.1

Mus musculus asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase) (Alg9), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Alg9 (102580)
Length:
2722
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045601.1
NBCI Gene record:
Alg9 (102580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429640 GAATTTAGGACACCCGTATTG pLKO_005 1112 3UTR 100% 10.800 15.120 N Alg9 n/a
2 TRCN0000379154 CGCCATGACGGGATGGTATAT pLKO_005 695 3UTR 100% 13.200 10.560 N Alg9 n/a
3 TRCN0000374508 GGTCATTGACAGCTACTATTA pLKO_005 890 3UTR 100% 13.200 10.560 N Alg9 n/a
4 TRCN0000124254 GCATCCTGTTAGAGCTGTAAT pLKO.1 1992 3UTR 100% 13.200 9.240 N Alg9 n/a
5 TRCN0000315491 GCATCCTGTTAGAGCTGTAAT pLKO_005 1992 3UTR 100% 13.200 9.240 N Alg9 n/a
6 TRCN0000446962 GCCTAGTTGCCAACCAGATAT pLKO_005 2398 3UTR 100% 13.200 9.240 N Alg9 n/a
7 TRCN0000124256 CGTCTCATGGACCTGATCTTT pLKO.1 961 3UTR 100% 5.625 3.938 N Alg9 n/a
8 TRCN0000308346 CGTCTCATGGACCTGATCTTT pLKO_005 961 3UTR 100% 5.625 3.938 N Alg9 n/a
9 TRCN0000124258 GCCTTCCAGATACATTGACAT pLKO.1 1658 3UTR 100% 4.950 3.465 N Alg9 n/a
10 TRCN0000308414 GCCTTCCAGATACATTGACAT pLKO_005 1658 3UTR 100% 4.950 3.465 N Alg9 n/a
11 TRCN0000124255 GCGCCAATGTATATTTGGTTT pLKO.1 1143 3UTR 100% 4.950 3.465 N Alg9 n/a
12 TRCN0000124257 GCTGCATTTCATGCACGGATT pLKO.1 530 3UTR 100% 4.050 2.835 N Alg9 n/a
13 TRCN0000294152 GTCATTGACAGCTACTATTAT pLKO_005 891 3UTR 100% 15.000 10.500 N ALG9 n/a
14 TRCN0000034723 CCAACACACTACCTCATCTAT pLKO.1 428 3UTR 100% 5.625 3.938 N ALG9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04128 pDONR223 100% 54.6% None (many diffs) n/a
2 ccsbBroad304_04128 pLX_304 0% 54.6% V5 (many diffs) n/a
3 TRCN0000474722 TATCTAAGCAAAACTACTGACCCT pLX_317 23.2% 54.6% V5 (many diffs) n/a
Download CSV