Transcript: Human NR_047584.1

Homo sapiens interleukin 12 receptor subunit beta 2 (IL12RB2), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-09-17
Taxon:
Homo sapiens (human)
Gene:
IL12RB2 (3595)
Length:
4133
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_047584.1
NBCI Gene record:
IL12RB2 (3595)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_047584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058161 CCTCCTCCATTATAGGATATA pLKO.1 2296 3UTR 100% 13.200 18.480 N IL12RB2 n/a
2 TRCN0000436750 TACGGAGTCGACCCTACAATG pLKO_005 2061 3UTR 100% 10.800 15.120 N IL12RB2 n/a
3 TRCN0000413042 TTCCAGACGTAACAAGTTAAT pLKO_005 826 3UTR 100% 13.200 9.240 N IL12RB2 n/a
4 TRCN0000427367 GCTACTTACCCTCCAACATAG pLKO_005 3129 3UTR 100% 10.800 7.560 N IL12RB2 n/a
5 TRCN0000058158 CCTGTATCAATAGTGATGAAA pLKO.1 951 3UTR 100% 5.625 3.938 N IL12RB2 n/a
6 TRCN0000058159 CCTGGGTAACTCTAAGCACAA pLKO.1 2176 3UTR 100% 4.050 2.835 N IL12RB2 n/a
7 TRCN0000058160 CCCACTTATACACTGAGTATA pLKO.1 1092 3UTR 100% 1.320 0.924 N IL12RB2 n/a
8 TRCN0000067719 GCTCTGATTTCAGAGAACATA pLKO.1 2087 3UTR 100% 0.563 0.394 N Il12rb2 n/a
9 TRCN0000058162 CCACGGAAATGAGAGGGAATT pLKO.1 2464 3UTR 100% 0.000 0.000 N IL12RB2 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2622 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4104 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2659 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2659 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_047584.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491277 ATCCTAACGTAATTTTTTAATGAC pLX_317 10.6% 62.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06446 pDONR223 100% 62.4% None (many diffs) n/a
3 ccsbBroad304_06446 pLX_304 0% 62.4% V5 (many diffs) n/a
4 TRCN0000481116 AATCCCCGCATTTGGATCTGTTCC pLX_317 14.6% 62.4% V5 (many diffs) n/a
Download CSV