Transcript: Human NR_073060.1

Homo sapiens formation of mitochondrial complex V assembly factor 1 homolog (FMC1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-04-10
Taxon:
Homo sapiens (human)
Gene:
FMC1 (154791)
Length:
969
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073060.1
NBCI Gene record:
FMC1 (154791)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163380 GATGCTGCATTCATAGGAGAA pLKO.1 373 3UTR 100% 4.050 3.240 N FMC1 n/a
2 TRCN0000159440 GCATTCATAGGAGAATTGAAT pLKO.1 379 3UTR 100% 0.563 0.394 N FMC1 n/a
3 TRCN0000330663 GCATTCATAGGAGAATTGAAT pLKO_005 379 3UTR 100% 0.563 0.394 N FMC1 n/a
4 TRCN0000165052 GAATTTCATGGCAAGGGTGAG pLKO.1 256 3UTR 100% 2.250 1.350 N FMC1 n/a
5 TRCN0000165861 GTGGCCCTACATCAGGAATTT pLKO.1 241 3UTR 100% 13.200 6.600 Y FMC1 n/a
6 TRCN0000163507 GCCCTACATCAGGAATTTCAT pLKO.1 244 3UTR 100% 5.625 2.813 Y FMC1 n/a
7 TRCN0000330662 GCCCTACATCAGGAATTTCAT pLKO_005 244 3UTR 100% 5.625 2.813 Y FMC1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 625 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000165902 GAAACATGTGGCCCTACATCA pLKO.1 234 3UTR 100% 4.950 2.475 Y FMC1 n/a
10 TRCN0000330661 GAAACATGTGGCCCTACATCA pLKO_005 234 3UTR 100% 4.950 2.475 Y FMC1 n/a
11 TRCN0000250875 TTCCAAGCTGCCACCTATCTC pLKO_005 193 3UTR 100% 4.950 2.475 Y Fmc1 n/a
12 TRCN0000162525 CAACATGAGCTTCATTTCCAA pLKO.1 178 3UTR 100% 3.000 1.500 Y FMC1 n/a
13 TRCN0000164562 CCAACATGAGCTTCATTTCCA pLKO.1 177 3UTR 100% 3.000 1.500 Y FMC1 n/a
14 TRCN0000164105 CATCAGGAATTTCATGGCAAG pLKO.1 250 3UTR 100% 2.250 1.125 Y FMC1 n/a
15 TRCN0000166479 CAGGAATTTCATGGCAAGGGT pLKO.1 253 3UTR 100% 0.750 0.375 Y FMC1 n/a
16 TRCN0000163964 CATGAGCTTCATTTCCAAGCT pLKO.1 181 3UTR 100% 0.264 0.132 Y FMC1 n/a
17 TRCN0000330660 CATGAGCTTCATTTCCAAGCT pLKO_005 181 3UTR 100% 0.264 0.132 Y FMC1 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 626 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14409 pDONR223 100% 27.1% None (many diffs) n/a
2 ccsbBroad304_14409 pLX_304 0% 27.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469944 TAGAATGGACATGCAGTAGCCTAT pLX_317 100% 27.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV