Transcript: Human NR_073118.1

Homo sapiens cytokine receptor like factor 3 (CRLF3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
CRLF3 (51379)
Length:
2746
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073118.1
NBCI Gene record:
CRLF3 (51379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322834 CTCCAGAGCTCCGACTTATTT pLKO_005 816 3UTR 100% 15.000 10.500 N CRLF3 n/a
2 TRCN0000370377 AGTCTGAGCAGTCGAAGAAAT pLKO_005 754 3UTR 100% 13.200 9.240 N CRLF3 n/a
3 TRCN0000063378 CCAGTACAGATAGAAGAACTA pLKO.1 445 3UTR 100% 4.950 3.465 N CRLF3 n/a
4 TRCN0000300919 CCAGTACAGATAGAAGAACTA pLKO_005 445 3UTR 100% 4.950 3.465 N CRLF3 n/a
5 TRCN0000063382 GCACTTCGGAACGATTCTGAA pLKO.1 778 3UTR 100% 4.950 3.465 N CRLF3 n/a
6 TRCN0000300918 GCACTTCGGAACGATTCTGAA pLKO_005 778 3UTR 100% 4.950 3.465 N CRLF3 n/a
7 TRCN0000063379 CCCAGATAGGTCATTCCACAT pLKO.1 695 3UTR 100% 4.050 2.835 N CRLF3 n/a
8 TRCN0000063381 GCTGTGTGCATTAGTACAAAT pLKO.1 952 3UTR 100% 13.200 7.920 N CRLF3 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1967 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11616 pDONR223 100% 6.2% None (many diffs) n/a
2 ccsbBroad304_11616 pLX_304 0% 6.2% V5 (many diffs) n/a
3 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 6.2% V5 (many diffs) n/a
4 ccsbBroadEn_15487 pDONR223 0% 5.8% None (many diffs) n/a
5 ccsbBroad304_15487 pLX_304 0% 5.8% V5 (many diffs) n/a
6 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 5.8% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% 2.2% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% 2.2% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.2% V5 (many diffs) n/a
Download CSV