Transcript: Human NR_077247.1

Homo sapiens ribosomal protein S18 pseudogene 9 (RPS18P9), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RPS18P9 (645958)
Length:
993
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_077247.1
NBCI Gene record:
RPS18P9 (645958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_077247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074902 CTGGTTCTTGAACAGACAGAA pLKO.1 712 3UTR 100% 4.950 2.475 Y RPS18 n/a
2 TRCN0000290968 CTGGTTCTTGAACAGACAGAA pLKO_005 712 3UTR 100% 4.950 2.475 Y RPS18 n/a
3 TRCN0000074899 GAAGGATGTAAAGGATGGAAA pLKO.1 730 3UTR 100% 4.950 2.475 Y RPS18 n/a
4 TRCN0000290969 GAAGGATGTAAAGGATGGAAA pLKO_005 730 3UTR 100% 4.950 2.475 Y RPS18 n/a
5 TRCN0000074898 GCTCATGTGGTGTTGAGGAAA pLKO.1 590 3UTR 100% 4.950 2.475 Y RPS18 n/a
6 TRCN0000290966 GCTCATGTGGTGTTGAGGAAA pLKO_005 590 3UTR 100% 4.950 2.475 Y RPS18 n/a
7 TRCN0000240328 GGGCCGAAGATATGCTCATGT pLKO_005 577 3UTR 100% 4.950 2.475 Y RPS18P5 n/a
8 TRCN0000240326 TGAAGACCTGGAGCGACTGAA pLKO_005 793 3UTR 100% 4.950 2.475 Y RPS18P5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_077247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01456 pDONR223 100% 43.8% None (many diffs) n/a
2 ccsbBroad304_01456 pLX_304 0% 43.8% V5 (many diffs) n/a
3 TRCN0000476505 ATGGACGCGGAGAATAGACAACCA pLX_317 74.1% 43.8% V5 (many diffs) n/a
4 ccsbBroadEn_13726 pDONR223 100% 22.2% None 1_703del;903T>C;926_993del n/a
5 ccsbBroad304_13726 pLX_304 0% 22.2% V5 1_703del;903T>C;926_993del n/a
6 TRCN0000476266 ATCTAGTTGATTGCCCCTGCAAAC pLX_317 100% 22.2% V5 1_703del;903T>C;926_993del n/a
Download CSV