Transcript: Human NR_102748.1

Homo sapiens golgin A2 pseudogene (LOC727751), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC727751 (727751)
Length:
2856
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102748.1
NBCI Gene record:
LOC727751 (727751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_102748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144170 CGAGAAGAAAGGAAGAGAAAT pLKO.1 1059 3UTR 100% 13.200 6.600 Y GOLGA2P7 n/a
2 TRCN0000151702 CGAGAAGAAAGGAAGAGAAAT pLKO.1 1059 3UTR 100% 13.200 6.600 Y GOLGA2P10 n/a
3 TRCN0000139861 CTCTGGAATCCAGTCCCATTT pLKO.1 1313 3UTR 100% 10.800 5.400 Y GOLGA2P7 n/a
4 TRCN0000139536 CAGACTCTCAGACCTGAAGTA pLKO.1 986 3UTR 100% 4.950 2.475 Y GOLGA2P7 n/a
5 TRCN0000139037 CATCAGGGTAGCTGAAGGAAA pLKO.1 938 3UTR 100% 4.950 2.475 Y GOLGA2P7 n/a
6 TRCN0000139792 CCACTGGATTGCTGACAGATA pLKO.1 720 3UTR 100% 4.950 2.475 Y GOLGA2P7 n/a
7 TRCN0000196213 GAGAAGCTGCAGGAAAGTACA pLKO.1 458 3UTR 100% 4.950 2.475 Y GOLGA2P10 n/a
8 TRCN0000141857 GCGAGAAGAAAGGAAGAGAAA pLKO.1 1058 3UTR 100% 4.950 2.475 Y GOLGA2P7 n/a
9 TRCN0000152878 GCGAGAAGAAAGGAAGAGAAA pLKO.1 1058 3UTR 100% 4.950 2.475 Y GOLGA2P10 n/a
10 TRCN0000139633 CAAAGGAGTCAGGACTTGGAA pLKO.1 910 3UTR 100% 3.000 1.500 Y GOLGA2P7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10405 pDONR223 100% 8.2% None (many diffs) n/a
2 ccsbBroad304_10405 pLX_304 0% 8.2% V5 (many diffs) n/a
3 TRCN0000491372 AAACACTGATCAGAGAAGGTGCCA pLX_317 100% 8.2% V5 (many diffs) n/a
4 ccsbBroadEn_10257 pDONR223 100% 8.1% None (many diffs) n/a
5 ccsbBroad304_10257 pLX_304 0% 8.1% V5 (many diffs) n/a
6 TRCN0000468960 TCGGCCTTCATGGCTCTATACCCT pLX_317 100% 8.1% V5 (many diffs) n/a
Download CSV