Transcript: Human NR_103521.3

Homo sapiens leukocyte immunoglobulin like receptor B2 (LILRB2), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
LILRB2 (10288)
Length:
2847
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103521.3
NBCI Gene record:
LILRB2 (10288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416926 TGACGTTGGCTTTCGTATAAG pLKO_005 2346 3UTR 100% 13.200 18.480 N LILRB2 n/a
2 TRCN0000416153 GAAGTAAGAATGTGCTTTAAA pLKO_005 2224 3UTR 100% 15.000 10.500 N LILRB2 n/a
3 TRCN0000057034 CCACTCCGTCTAAGATCAATA pLKO.1 1225 3UTR 100% 13.200 9.240 N LILRB2 n/a
4 TRCN0000057036 GCGATATGGCTGTCAGTATTA pLKO.1 414 3UTR 100% 13.200 9.240 N LILRB2 n/a
5 TRCN0000057033 GCATCTTGGATTACACGGATA pLKO.1 331 3UTR 100% 4.050 2.835 N LILRB2 n/a
6 TRCN0000057035 TGGCGGCTTCATTCTGTGTAA pLKO.1 582 3UTR 100% 4.950 2.970 N LILRB2 n/a
7 TRCN0000057037 CGGCAGTTCCACACTTTCCTT pLKO.1 1177 3UTR 100% 3.000 1.800 N LILRB2 n/a
8 TRCN0000056874 GAGAAGATGAACACCCACAAT pLKO.1 608 3UTR 100% 4.950 2.475 Y LILRA1 n/a
9 TRCN0000056876 CCACACTTTCCTTCTGACCAA pLKO.1 1185 3UTR 100% 2.640 1.320 Y LILRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07695 pDONR223 100% 53.8% None (many diffs) n/a
2 ccsbBroad304_07695 pLX_304 0% 53.8% V5 (many diffs) n/a
3 TRCN0000477615 ACCTCCGGAGCACCCTCCTCATAA pLX_317 20.9% 53.8% V5 (many diffs) n/a
4 ccsbBroadEn_02599 pDONR223 100% 44.7% None (many diffs) n/a
5 ccsbBroad304_02599 pLX_304 0% 44.7% V5 (many diffs) n/a
6 TRCN0000476912 AATATTGCGCGCAACCGAGCATCT pLX_317 19.2% 44.7% V5 (many diffs) n/a
7 ccsbBroadEn_07730 pDONR223 100% 43.5% None (many diffs) n/a
8 ccsbBroad304_07730 pLX_304 0% 43.5% V5 (many diffs) n/a
9 ccsbBroadEn_07729 pDONR223 100% 40.8% None (many diffs) n/a
10 ccsbBroad304_07729 pLX_304 0% 40.8% V5 (many diffs) n/a
11 TRCN0000478306 AGCCAAGCTCAGGCTTTGGACACT pLX_317 25.7% 40.8% V5 (many diffs) n/a
Download CSV