Construct: ORF TRCN0000477615
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017478.1_s317c1
- Derived from:
- ccsbBroadEn_07695
- DNA Barcode:
- ACCTCCGGAGCACCCTCCTCATAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LILRB1 (10859)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477615
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_006669.6 | 99.7% | 99.6% | 276_277delCAinsTG;1866C>T;1873G>A |
2 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026185.1 | 99.7% | 99.6% | 276_277delCAinsTG;1866C>T;1873G>A |
3 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081638.3 | 99.6% | 99.5% | (many diffs) |
4 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081639.3 | 99.6% | 99.5% | (many diffs) |
5 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001081637.2 | 99.4% | 99.3% | (many diffs) |
6 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026183.2 | 98.2% | 98.1% | (many diffs) |
7 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026182.2 | 98.1% | 98% | (many diffs) |
8 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026184.2 | 97.7% | 96.9% | (many diffs) |
9 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526332.3 | 97.6% | 96.8% | (many diffs) |
10 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526331.2 | 97.4% | 96.6% | (many diffs) |
11 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278398.2 | 97.2% | 97% | (many diffs) |
12 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026190.1 | 97.2% | 97.1% | (many diffs) |
13 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026188.1 | 97.1% | 97% | (many diffs) |
14 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026189.1 | 97.1% | 97% | (many diffs) |
15 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026186.1 | 96.9% | 96.8% | (many diffs) |
16 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026187.1 | 96.9% | 96.8% | (many diffs) |
17 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526336.2 | 91.7% | 91.6% | (many diffs) |
18 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026191.1 | 91.6% | 91.5% | (many diffs) |
19 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_011526335.2 | 89.7% | 88.9% | (many diffs) |
20 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030299.1 | 82.8% | 73% | (many diffs) |
21 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001080978.4 | 82.8% | 77.8% | (many diffs) |
22 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278403.2 | 82.8% | 77.8% | (many diffs) |
23 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_005874.5 | 82.6% | 77.7% | (many diffs) |
24 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030297.1 | 81% | 71.5% | (many diffs) |
25 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XM_017030296.1 | 80.9% | 71.4% | (many diffs) |
26 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278405.2 | 69.6% | 62.5% | (many diffs) |
27 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NM_001278399.2 | 69.6% | 69.5% | (many diffs) |
28 | human | 107987462 | LOC107987462 | leukocyte immunoglobulin-li... | XR_001756804.1 | 68.4% | (many diffs) | |
29 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526362.2 | 67.9% | 58.2% | (many diffs) |
30 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278404.2 | 67.8% | 63.7% | (many diffs) |
31 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | NR_103518.2 | 66.5% | (many diffs) | |
32 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001290271.2 | 66.5% | 57.2% | (many diffs) |
33 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_006722986.1 | 66.5% | 57.2% | (many diffs) |
34 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XM_017026192.1 | 66% | 65.9% | (many diffs) |
35 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001130917.3 | 64.7% | 56.4% | (many diffs) |
36 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526385.1 | 64.7% | 56.4% | (many diffs) |
37 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526386.1 | 64.7% | 55.3% | (many diffs) |
38 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_006863.4 | 64.4% | 57.9% | (many diffs) |
39 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_006866.4 | 63.5% | 55.5% | (many diffs) |
40 | human | 11026 | LILRA3 | leukocyte immunoglobulin li... | NM_006865.4 | 61.8% | 56.7% | (many diffs) |
41 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | NM_001290270.1 | 61.8% | 53.6% | (many diffs) |
42 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526387.1 | 61.8% | 53.6% | (many diffs) |
43 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NM_001278406.2 | 61.2% | 56.5% | (many diffs) |
44 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_001278319.1 | 61.1% | 56% | (many diffs) |
45 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_935716.2 | 59.1% | (many diffs) | |
46 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526388.1 | 58.2% | 51.2% | (many diffs) |
47 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278427.3 | 58.1% | 48.8% | (many diffs) |
48 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_001753591.1 | 58% | (many diffs) | |
49 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278426.3 | 58% | 48.7% | (many diffs) |
50 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | NM_001278428.3 | 58% | 48.7% | (many diffs) |
51 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_002958244.1 | 56% | (many diffs) | |
52 | human | 10859 | LILRB1 | leukocyte immunoglobulin li... | XR_001753590.2 | 55.9% | (many diffs) | |
53 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_017026217.1 | 54.7% | 46% | (many diffs) |
54 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135495.2 | 54.7% | (many diffs) | |
55 | human | 11006 | LILRB4 | leukocyte immunoglobulin li... | XM_024451331.1 | 54.6% | 45.9% | (many diffs) |
56 | human | 10288 | LILRB2 | leukocyte immunoglobulin li... | NR_103521.3 | 53.8% | (many diffs) | |
57 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135494.2 | 52.9% | (many diffs) | |
58 | human | 11026 | LILRA3 | leukocyte immunoglobulin li... | NM_001172654.2 | 52.7% | 48.3% | (many diffs) |
59 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_017026224.1 | 52.6% | 44.1% | (many diffs) |
60 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526389.1 | 51.2% | 42.9% | (many diffs) |
61 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526390.1 | 50.8% | 40% | (many diffs) |
62 | human | 11024 | LILRA1 | leukocyte immunoglobulin li... | NM_001278318.2 | 37.8% | 30.9% | (many diffs) |
63 | human | 11027 | LILRA2 | leukocyte immunoglobulin li... | XM_011526391.1 | 36.8% | 31.1% | (many diffs) |
64 | human | 107987441 | LOC107987441 | leukocyte immunoglobulin-li... | XM_017030292.1 | 34.4% | 30.7% | (many diffs) |
65 | human | 112268334 | LOC112268334 | leukocyte immunoglobulin-li... | XM_024452538.1 | 34.4% | 30.7% | (many diffs) |
66 | human | 112268336 | LOC112268336 | leukocyte immunoglobulin-li... | XM_024452546.1 | 34.4% | 30.7% | (many diffs) |
67 | human | 112268337 | LOC112268337 | leukocyte immunoglobulin-li... | XM_024452551.1 | 34.4% | 30.7% | (many diffs) |
68 | human | 112268340 | LOC112268340 | leukocyte immunoglobulin-li... | XM_024452562.1 | 34.4% | 30.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2016
- ORF length:
- 1950
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ccccatcctc acggtcctga tctgtctcgg gctgagtctg ggcccccgga 121 cccacgtgca ggcagggcac ctccccaagc ccaccctctg ggctgaacca ggctctgtga 181 tcacccaggg gagtcctgtg accctcaggt gtcagggggg ccaggagacc caggagtacc 241 gtctatatag agaaaagaaa acagcaccct ggattacacg gatcccacag gagcttgtga 301 agaagggcca gttccccatc ccatccatca cctgggaaca tgcagggcgg tatcgctgtt 361 actatggtag cgacactgca ggccgctcag agagcagtga ccccctggag ctggtggtga 421 caggagccta catcaaaccc accctctcag cccagcccag ccccgtggtg aactcaggag 481 ggaatgtaac cctccagtgt gactcacagg tggcatttga tggcttcatt ctgtgtaagg 541 aaggagaaga tgaacaccca caatgcctga actcccagcc ccatgcccgt gggtcgtccc 601 gcgccatctt ctccgtgggc cccgtgagcc cgagtcgcag gtggtggtac aggtgctatg 661 cttatgactc gaactctccc tatgagtggt ctctacccag tgatctcctg gagctcctgg 721 tcctaggtgt ttctaagaag ccatcactct cagtgcagcc aggtcctatc gtggcccctg 781 aggagaccct gactctgcag tgtggctctg atgctggcta caacagattt gttctgtata 841 aggacgggga acgtgacttc cttcagctcg ctggcgcaca gccccaggct gggctctccc 901 aggccaactt caccctgggc cctgtgagcc gctcctacgg gggccagtac agatgctacg 961 gtgcacacaa cctctcctcc gagtggtcgg cccccagcga ccccctggac atcctgatcg 1021 caggacagtt ctatgacaga gtctccctct cggtgcagcc gggccccacg gtggcctcag 1081 gagagaacgt gaccctgctg tgtcagtcac agggatggat gcaaactttc cttctgacca 1141 aggagggggc agctgatgac ccatggcgtc taagatcaac gtaccaatct caaaaatacc 1201 aggctgaatt ccccatgggt cctgtgacct cagcccatgc ggggacctac aggtgctacg 1261 gctcacagag ctccaaaccc tacctgctga ctcaccccag tgaccccctg gagctcgtgg 1321 tctcaggacc gtctgggggc cccagctccc cgacaacagg ccccacctcc acatctggcc 1381 ctgaggacca gcccctcacc cccaccgggt cggatcccca gagtggtctg ggaaggcacc 1441 tgggggttgt gatcggcatc ttggtggccg tcatcctact gctcctcctc ctcctcctcc 1501 tcttcctcat cctccgacat cgacgtcagg gcaaacactg gacatcgacc cagagaaagg 1561 ctgatttcca acatcctgca ggggctgtgg ggccagagcc cacagacaga ggccTGCAGT 1621 GGAGGTCCAG CCCAGCTGCC GATGCCCAGG AAGAAAACCT CTATGCTGCC GTGAAGCACA 1681 CACAGCCTGA GGATGGGGTG GAGATGGACA CTCGGAGCCC ACACGATGAA GACCCCCAGG 1741 CAGTGACGTA TGCCGAGGTG AAACACTCCA GACCTAGGAG AGAAATGGCC TCTCCTCCTT 1801 CCCCACTGTC TGGGGAATTC CTGGACACAA AGGACAGACA GGCGGAAGAG GACAGGCAGA 1861 TGGACACTGA GGCTGCTGCA TCTGAAGCCC CCCAGGATGT GACCTACGCC CAGCTGCACA 1921 GCTTGACCCT TAGACGGAAG GCAACTGAGC CTCCTCCATC CCAGGAAGGG CCCTCTCCAG 1981 CTGTGCCCAG CATCTACGCC ACTCTGGCCA TCCACTACCC AACTTTCTTG TACAAAGTGG 2041 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 2101 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 2161 AACCTCCGGA GCACCCTCCT CATAAACGCG TTAAGTCgac aatcaacctc tggattacaa 2221 aatttgtgaa agatt