Transcript: Human NR_104293.2

Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
ACSF3 (197322)
Length:
3752
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104293.2
NBCI Gene record:
ACSF3 (197322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155266 GATGGGCAAGATTGACAAGAA pLKO.1 2071 3UTR 100% 4.950 6.930 N ACSF3 n/a
2 TRCN0000231121 CTCAAAGAGTGGGCCAGAAAT pLKO_005 1988 3UTR 100% 13.200 17.160 N ACSF3 n/a
3 TRCN0000231120 ACCCTCCGTGTTTCGAGAATA pLKO_005 1625 3UTR 100% 13.200 10.560 N ACSF3 n/a
4 TRCN0000218624 TTATGGCAGTGCCTACAATAT pLKO_005 1207 3UTR 100% 13.200 10.560 N ACSF3 n/a
5 TRCN0000156690 GCACCCACGTTGCATTTACTT pLKO.1 3020 3UTR 100% 5.625 4.500 N ACSF3 n/a
6 TRCN0000156922 GCCTGAACTTACCCAGAACAT pLKO.1 3169 3UTR 100% 4.950 3.960 N ACSF3 n/a
7 TRCN0000231122 CAAATCAGGTCACGTAGAATC pLKO_005 2231 3UTR 100% 10.800 7.560 N ACSF3 n/a
8 TRCN0000155629 CCTGAACTTACCCAGAACATT pLKO.1 3170 3UTR 100% 5.625 3.938 N ACSF3 n/a
9 TRCN0000157714 CATCAAGACTGGAGGCTACAA pLKO.1 1819 3UTR 100% 4.950 3.465 N ACSF3 n/a
10 TRCN0000156573 GCTGGAGAAGTGGAAGAACAT pLKO.1 1355 3UTR 100% 4.950 3.465 N ACSF3 n/a
11 TRCN0000156364 CAGGATTTCTTGCGTGCAGTT pLKO.1 1278 3UTR 100% 4.050 2.835 N ACSF3 n/a
12 TRCN0000157272 GATGTGGCTGTGATTGGAGTT pLKO.1 1892 3UTR 100% 4.050 2.835 N ACSF3 n/a
13 TRCN0000156574 GTGGACATCATCAAGACTGGA pLKO.1 1811 3UTR 100% 2.640 1.848 N ACSF3 n/a
14 TRCN0000150724 CCAGAAGTTTCTGGACAATTT pLKO.1 3081 3UTR 100% 1.320 0.924 N ACSF3 n/a
15 TRCN0000154382 CGGATCAATGTCTTTATGGCA pLKO.1 1194 3UTR 100% 0.750 0.525 N ACSF3 n/a
16 TRCN0000231119 ACACGTACAGGGAGCTTTATT pLKO_005 535 3UTR 100% 15.000 9.000 N ACSF3 n/a
17 TRCN0000156424 CATCATCAAGACTGGAGGCTA pLKO.1 1816 3UTR 100% 2.640 1.584 N ACSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09794 pDONR223 100% 45.8% None (many diffs) n/a
2 ccsbBroad304_09794 pLX_304 0% 45.8% V5 (many diffs) n/a
3 TRCN0000477630 CGCGGCACAGGGACTCTTGGTCTT pLX_317 22.2% 45.8% V5 (many diffs) n/a
Download CSV