Transcript: Mouse NR_104446.1

Mus musculus reticulon 1 (Rtn1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rtn1 (104001)
Length:
1438
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104446.1
NBCI Gene record:
Rtn1 (104001)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119371 GTGGCAAAGATCCAGGCTAAA pLKO.1 602 3UTR 100% 10.800 15.120 N Rtn1 n/a
2 TRCN0000119368 CGCATCTACAAGTCCGTTCTA pLKO.1 236 3UTR 100% 4.950 6.930 N Rtn1 n/a
3 TRCN0000119367 GCAAATTGATTGTTTCCCTTT pLKO.1 727 3UTR 100% 4.050 2.835 N Rtn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104446.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11112 pDONR223 100% 36.9% None (many diffs) n/a
2 ccsbBroad304_11112 pLX_304 0% 36.9% V5 (many diffs) n/a
3 TRCN0000470254 CCCCTCTTGGAGGTTCAATCCCAT pLX_317 57.8% 36.9% V5 (many diffs) n/a
4 ccsbBroadEn_11113 pDONR223 100% 19.7% None (many diffs) n/a
5 ccsbBroad304_11113 pLX_304 0% 19.7% V5 (many diffs) n/a
Download CSV