Transcript: Human NR_104455.2

Homo sapiens FERM domain containing 5 (FRMD5), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
FRMD5 (84978)
Length:
5367
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104455.2
NBCI Gene record:
FRMD5 (84978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438088 GCGGAACCATCGGCACATATA pLKO_005 2324 3UTR 100% 13.200 18.480 N FRMD5 n/a
2 TRCN0000422352 GACTTTCTATTTATACGTAAG pLKO_005 1282 3UTR 100% 6.000 8.400 N FRMD5 n/a
3 TRCN0000417030 GTTCTAAGTGTCCTCCGTTTG pLKO_005 2025 3UTR 100% 6.000 8.400 N FRMD5 n/a
4 TRCN0000429620 ACGGAACTGAGTGGTCAAACA pLKO_005 1061 3UTR 100% 4.950 6.930 N FRMD5 n/a
5 TRCN0000071902 GTCCACTTCATTAAATGGAAT pLKO.1 1232 3UTR 100% 4.950 3.960 N Frmd5 n/a
6 TRCN0000420899 CAGTGTCCAGCAGCAATTTAT pLKO_005 1431 3UTR 100% 15.000 10.500 N FRMD5 n/a
7 TRCN0000427102 ACCTACTTGAGAAAGACTATT pLKO_005 369 3UTR 100% 13.200 9.240 N FRMD5 n/a
8 TRCN0000434856 TGAACAATTCCACTATCAATA pLKO_005 2156 3UTR 100% 13.200 9.240 N FRMD5 n/a
9 TRCN0000131096 GAGGAGGAGAAGGAATCTGAA pLKO.1 1902 3UTR 100% 4.950 3.465 N FRMD5 n/a
10 TRCN0000071900 GCACCTCTGGAAATGTGGAAT pLKO.1 1363 3UTR 100% 4.950 3.465 N Frmd5 n/a
11 TRCN0000128657 CATCTTTCCAATTTGCAGGAT pLKO.1 2498 3UTR 100% 2.640 1.848 N FRMD5 n/a
12 TRCN0000130585 CCTGTCTAAACAAACTGGGAA pLKO.1 2425 3UTR 100% 2.640 1.848 N FRMD5 n/a
13 TRCN0000129390 GAAGAGCTGTTCACATCTCCA pLKO.1 1639 3UTR 100% 2.640 1.848 N FRMD5 n/a
14 TRCN0000129443 GATCATCCTTACCGAGTCTGA pLKO.1 2090 3UTR 100% 2.640 1.848 N FRMD5 n/a
15 TRCN0000129461 GTCTGACCTTGACATTGCCTT pLKO.1 2105 3UTR 100% 2.640 1.848 N FRMD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104455.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04460 pDONR223 100% 31.8% None (many diffs) n/a
2 ccsbBroad304_04460 pLX_304 0% 31.8% V5 (many diffs) n/a
3 TRCN0000474059 TCGCGCAACGAACCCGAAAAGTAT pLX_317 21.4% 31.8% V5 (many diffs) n/a
4 TRCN0000488208 TTAAATAGAAGTAGCAAACTCACT pLX_317 16.9% 31.8% V5 (many diffs) n/a
5 TRCN0000489266 GTTACTGTCGCAATGCCTAACCAT pLX_317 21% 31.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV