Transcript: Human NR_109844.1

Homo sapiens CAP-Gly domain containing linker protein family member 4 (CLIP4), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
CLIP4 (79745)
Length:
2314
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_109844.1
NBCI Gene record:
CLIP4 (79745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_109844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138676 GCTGGCATTGAACTGGATGAA pLKO.1 1130 3UTR 100% 4.950 3.960 N CLIP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_109844.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08954 pDONR223 100% 73.5% None (many diffs) n/a
2 ccsbBroad304_08954 pLX_304 0% 73.5% V5 (many diffs) n/a
3 TRCN0000467345 CTTTCTCAACCTAGGCCGGTAGAG pLX_317 14.7% 73.5% V5 (many diffs) n/a
4 ccsbBroadEn_15989 pDONR223 0% 63% None (many diffs) n/a
5 ccsbBroad304_15989 pLX_304 0% 63% V5 (many diffs) n/a
Download CSV