Transcript: Human NR_109997.1

Homo sapiens PRKAR2A antisense RNA 1 (PRKAR2A-AS1), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
PRKAR2A-AS1 (100506637)
Length:
3406
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_109997.1
NBCI Gene record:
PRKAR2A-AS1 (100506637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_109997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 1288 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
2 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 1288 3UTR 100% 1.080 0.540 Y TNNI1 n/a
3 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 996 3UTR 100% 5.625 2.813 Y KLHL30 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 996 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_109997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 6.3% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 6.3% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 6.3% V5 (many diffs) n/a
4 ccsbBroadEn_10261 pDONR223 100% 1.8% None (many diffs) n/a
5 ccsbBroad304_10261 pLX_304 0% 1.8% V5 (many diffs) n/a
6 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.8% V5 (many diffs) n/a
Download CSV